Mutagenetix > Incidental Mutations

Incidental Mutation 'R3895:Ptpn14'

310479

Institutional Source

Beutler Lab

Gene Symbol

Ptpn14

Ensembl Gene

ENSMUSG00000026604

Gene Name

protein tyrosine phosphatase, non-receptor type 14

Synonyms

C130080N23Rik, PTP36, OTTMUSG00000022087

MMRRC Submission

040806-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3895 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

189728268-189876695 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 189850546 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 530 (A530V)

Ref Sequence

ENSEMBL: ENSMUSP00000095051 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027898] [ENSMUST00000097442]

Predicted Effect

probably benign
Transcript: ENSMUST00000027898

SMART Domains

Protein: ENSMUSP00000027898
Gene: ENSMUSG00000026604

Domain	Start	End	E-Value	Type
B41	17	220	3.7e-67	SMART
FERM_C	224	310	3.43e-15	SMART
low complexity region	565	575	N/A	INTRINSIC
low complexity region	633	639	N/A	INTRINSIC
low complexity region	710	718	N/A	INTRINSIC
low complexity region	745	758	N/A	INTRINSIC
low complexity region	817	834	N/A	INTRINSIC
PTPc	910	1184	2.14e-103	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000097442
AA Change: A530V

PolyPhen 2 Score 0.315 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000095051
Gene: ENSMUSG00000026604
AA Change: A530V

Domain	Start	End	E-Value	Type
B41	17	220	3.7e-67	SMART
FERM_C	224	310	3.43e-15	SMART
low complexity region	565	575	N/A	INTRINSIC
low complexity region	633	639	N/A	INTRINSIC
low complexity region	710	718	N/A	INTRINSIC
low complexity region	745	758	N/A	INTRINSIC
low complexity region	817	834	N/A	INTRINSIC
PTPc	910	1184	2.14e-103	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128275

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195038

Meta Mutation Damage Score

0.0818

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

96% (45/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an N-terminal noncatalytic domain similar to that of band 4.1 superfamily cytoskeleton-associated proteins, which suggested the membrane or cytoskeleton localization of this protein. It appears to regulate lymphatic development in mammals, and a loss of function mutation has been found in a kindred with a lymphedema-choanal atresia. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit some postnatal growth retardation, decreased body weight, periorbital and limb edema, and lymphatic vessel hyperplasia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acoxl	T	C	2: 127,972,525		probably benign	Het
C6	T	C	15: 4,808,470	V854A	probably benign	Het
Ccnd1	T	C	7: 144,937,894	E136G	probably damaging	Het
CK137956	A	T	4: 127,946,648	F422I	probably benign	Het
Csta1	T	C	16: 36,131,032	T7A	probably benign	Het
Dock8	A	G	19: 25,051,501	E23G	probably benign	Het
Fbxo8	A	T	8: 56,591,521	R286S	probably damaging	Het
Gm12258	T	G	11: 58,858,549	Y183*	probably null	Het
Gm4759	T	A	7: 106,423,414	H127L	probably damaging	Het
Hectd3	A	G	4: 116,996,089	D171G	probably damaging	Het
Hoxd11	C	T	2: 74,682,792	R134W	probably damaging	Het
Ighg2c	T	C	12: 113,287,658	T246A	unknown	Het
Ints6	T	C	14: 62,696,611	I816V	probably damaging	Het
Lrp4	G	A	2: 91,473,949	G158S	probably damaging	Het
Mast1	G	A	8: 84,935,723	P52L	probably damaging	Het
Med13l	A	G	5: 118,761,323	D2148G	probably null	Het
Med24	A	G	11: 98,706,388	S889P	probably benign	Het
Mgam	T	A	6: 40,759,120	M851K	probably damaging	Het
Mkln1	T	A	6: 31,507,667	L710H	probably damaging	Het
Morf4l1	A	T	9: 90,094,448	F276I	possibly damaging	Het
Mslnl	G	A	17: 25,742,934	V128M	probably damaging	Het
Myt1	T	A	2: 181,820,070	S574R	probably damaging	Het
Nol11	C	A	11: 107,168,347	V644F	probably damaging	Het
Nusap1	C	A	2: 119,627,691	Q103K	possibly damaging	Het
Ovgp1	A	G	3: 105,986,596		probably benign	Het
Pcdh9	C	T	14: 93,887,538	V399M	probably damaging	Het
Plekhh1	T	C	12: 79,055,232	S359P	probably benign	Het
Prg4	G	C	1: 150,454,759		probably benign	Het
Rho	A	G	6: 115,933,902	Y136C	probably damaging	Het
Rps3	C	T	7: 99,479,896	R173H	probably benign	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Sall2	T	C	14: 52,314,047	N564D	probably damaging	Het
Sart3	G	A	5: 113,752,427	R452*	probably null	Het
Sbf2	T	C	7: 110,447,091	I300V	probably damaging	Het
Sgo2b	A	T	8: 63,928,733	V355E	possibly damaging	Het
Slc22a5	T	C	11: 53,865,825	K553R	possibly damaging	Het
Syne1	A	G	10: 5,405,456	V375A	probably damaging	Het
Trafd1	T	C	5: 121,378,741	E28G	probably benign	Het
Tsc2	T	C	17: 24,599,812	K1292R	probably damaging	Het
Twnk	A	G	19: 45,007,451	T108A	probably damaging	Het
Unc13c	A	T	9: 73,933,523	H15Q	probably benign	Het
Vps16	T	C	2: 130,438,676	S208P	possibly damaging	Het

Other mutations in Ptpn14

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01014:Ptpn14	APN	1	189822633	missense	probably damaging	1.00
IGL02501:Ptpn14	APN	1	189850390	missense	probably benign	0.14
IGL03011:Ptpn14	APN	1	189839557	missense	probably damaging	1.00
R0724:Ptpn14	UTSW	1	189850947	missense	possibly damaging	0.52
R0791:Ptpn14	UTSW	1	189836440	splice site	probably benign
R1363:Ptpn14	UTSW	1	189798628	missense	probably damaging	1.00
R1605:Ptpn14	UTSW	1	189865512	missense	probably benign	0.00
R1840:Ptpn14	UTSW	1	189786851	missense	probably damaging	1.00
R1845:Ptpn14	UTSW	1	189839502	missense	possibly damaging	0.96
R1891:Ptpn14	UTSW	1	189798653	missense	probably damaging	1.00
R2187:Ptpn14	UTSW	1	189863228	nonsense	probably null
R2288:Ptpn14	UTSW	1	189865498	missense	probably damaging	1.00
R3686:Ptpn14	UTSW	1	189851399	missense	probably damaging	1.00
R3898:Ptpn14	UTSW	1	189850531	missense	probably benign	0.35
R4004:Ptpn14	UTSW	1	189850510	missense	probably benign	0.00
R4816:Ptpn14	UTSW	1	189856800	missense	probably damaging	1.00
R4883:Ptpn14	UTSW	1	189850800	missense	probably damaging	0.99
R4928:Ptpn14	UTSW	1	189822642	missense	probably damaging	1.00
R4931:Ptpn14	UTSW	1	189851277	missense	probably benign
R4957:Ptpn14	UTSW	1	189851272	missense	probably benign	0.02
R5009:Ptpn14	UTSW	1	189850534	missense	probably benign
R5038:Ptpn14	UTSW	1	189786886	missense	probably damaging	1.00
R5264:Ptpn14	UTSW	1	189832800	critical splice donor site	probably null
R5373:Ptpn14	UTSW	1	189850963	missense	probably benign
R5441:Ptpn14	UTSW	1	189798570	missense	probably damaging	1.00
R5540:Ptpn14	UTSW	1	189846364	missense	probably benign	0.05
R5638:Ptpn14	UTSW	1	189786841	missense	probably damaging	1.00
R5746:Ptpn14	UTSW	1	189846413	critical splice donor site	probably null
R5872:Ptpn14	UTSW	1	189851032	missense	probably benign	0.00
R5988:Ptpn14	UTSW	1	189850387	missense	probably damaging	1.00
R6139:Ptpn14	UTSW	1	189851165	missense	probably benign	0.01
R6295:Ptpn14	UTSW	1	189850800	missense	probably damaging	0.99
R6770:Ptpn14	UTSW	1	189832773	missense	probably damaging	1.00
R7097:Ptpn14	UTSW	1	189863398	nonsense	probably null
R7320:Ptpn14	UTSW	1	189832759	missense	probably benign	0.11
R7324:Ptpn14	UTSW	1	189863424	missense	possibly damaging	0.46
R7599:Ptpn14	UTSW	1	189850745	missense	probably benign	0.39
R7699:Ptpn14	UTSW	1	189865411	missense	probably benign	0.08
R7700:Ptpn14	UTSW	1	189865411	missense	probably benign	0.08
R8379:Ptpn14	UTSW	1	189833401	missense	possibly damaging	0.95
Z1177:Ptpn14	UTSW	1	189860470	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GGTCTCTGCGTAACCTCAATATC -3'
(R):5'- TTACCAGATCAGGGCTGCTG -3'

Sequencing Primer
(F):5'- TCTGCGTAACCTCAATATCATCAAC -3'
(R):5'- TGCCGCTGACGTACTTG -3'

Posted On

2015-04-17