Incidental Mutation 'R3895:Ptpn14'
ID310479
Institutional Source Beutler Lab
Gene Symbol Ptpn14
Ensembl Gene ENSMUSG00000026604
Gene Nameprotein tyrosine phosphatase, non-receptor type 14
SynonymsC130080N23Rik, PTP36, OTTMUSG00000022087
MMRRC Submission 040806-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3895 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location189728268-189876695 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 189850546 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 530 (A530V)
Ref Sequence ENSEMBL: ENSMUSP00000095051 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027898] [ENSMUST00000097442]
Predicted Effect probably benign
Transcript: ENSMUST00000027898
SMART Domains Protein: ENSMUSP00000027898
Gene: ENSMUSG00000026604

DomainStartEndE-ValueType
B41 17 220 3.7e-67 SMART
FERM_C 224 310 3.43e-15 SMART
low complexity region 565 575 N/A INTRINSIC
low complexity region 633 639 N/A INTRINSIC
low complexity region 710 718 N/A INTRINSIC
low complexity region 745 758 N/A INTRINSIC
low complexity region 817 834 N/A INTRINSIC
PTPc 910 1184 2.14e-103 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097442
AA Change: A530V

PolyPhen 2 Score 0.315 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000095051
Gene: ENSMUSG00000026604
AA Change: A530V

DomainStartEndE-ValueType
B41 17 220 3.7e-67 SMART
FERM_C 224 310 3.43e-15 SMART
low complexity region 565 575 N/A INTRINSIC
low complexity region 633 639 N/A INTRINSIC
low complexity region 710 718 N/A INTRINSIC
low complexity region 745 758 N/A INTRINSIC
low complexity region 817 834 N/A INTRINSIC
PTPc 910 1184 2.14e-103 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128275
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195038
Meta Mutation Damage Score 0.0818 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 96% (45/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an N-terminal noncatalytic domain similar to that of band 4.1 superfamily cytoskeleton-associated proteins, which suggested the membrane or cytoskeleton localization of this protein. It appears to regulate lymphatic development in mammals, and a loss of function mutation has been found in a kindred with a lymphedema-choanal atresia. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit some postnatal growth retardation, decreased body weight, periorbital and limb edema, and lymphatic vessel hyperplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acoxl T C 2: 127,972,525 probably benign Het
C6 T C 15: 4,808,470 V854A probably benign Het
Ccnd1 T C 7: 144,937,894 E136G probably damaging Het
CK137956 A T 4: 127,946,648 F422I probably benign Het
Csta1 T C 16: 36,131,032 T7A probably benign Het
Dock8 A G 19: 25,051,501 E23G probably benign Het
Fbxo8 A T 8: 56,591,521 R286S probably damaging Het
Gm12258 T G 11: 58,858,549 Y183* probably null Het
Gm4759 T A 7: 106,423,414 H127L probably damaging Het
Hectd3 A G 4: 116,996,089 D171G probably damaging Het
Hoxd11 C T 2: 74,682,792 R134W probably damaging Het
Ighg2c T C 12: 113,287,658 T246A unknown Het
Ints6 T C 14: 62,696,611 I816V probably damaging Het
Lrp4 G A 2: 91,473,949 G158S probably damaging Het
Mast1 G A 8: 84,935,723 P52L probably damaging Het
Med13l A G 5: 118,761,323 D2148G probably null Het
Med24 A G 11: 98,706,388 S889P probably benign Het
Mgam T A 6: 40,759,120 M851K probably damaging Het
Mkln1 T A 6: 31,507,667 L710H probably damaging Het
Morf4l1 A T 9: 90,094,448 F276I possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myt1 T A 2: 181,820,070 S574R probably damaging Het
Nol11 C A 11: 107,168,347 V644F probably damaging Het
Nusap1 C A 2: 119,627,691 Q103K possibly damaging Het
Ovgp1 A G 3: 105,986,596 probably benign Het
Pcdh9 C T 14: 93,887,538 V399M probably damaging Het
Plekhh1 T C 12: 79,055,232 S359P probably benign Het
Prg4 G C 1: 150,454,759 probably benign Het
Rho A G 6: 115,933,902 Y136C probably damaging Het
Rps3 C T 7: 99,479,896 R173H probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sall2 T C 14: 52,314,047 N564D probably damaging Het
Sart3 G A 5: 113,752,427 R452* probably null Het
Sbf2 T C 7: 110,447,091 I300V probably damaging Het
Sgo2b A T 8: 63,928,733 V355E possibly damaging Het
Slc22a5 T C 11: 53,865,825 K553R possibly damaging Het
Syne1 A G 10: 5,405,456 V375A probably damaging Het
Trafd1 T C 5: 121,378,741 E28G probably benign Het
Tsc2 T C 17: 24,599,812 K1292R probably damaging Het
Twnk A G 19: 45,007,451 T108A probably damaging Het
Unc13c A T 9: 73,933,523 H15Q probably benign Het
Vps16 T C 2: 130,438,676 S208P possibly damaging Het
Other mutations in Ptpn14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Ptpn14 APN 1 189822633 missense probably damaging 1.00
IGL02501:Ptpn14 APN 1 189850390 missense probably benign 0.14
IGL03011:Ptpn14 APN 1 189839557 missense probably damaging 1.00
R0724:Ptpn14 UTSW 1 189850947 missense possibly damaging 0.52
R0791:Ptpn14 UTSW 1 189836440 splice site probably benign
R1363:Ptpn14 UTSW 1 189798628 missense probably damaging 1.00
R1605:Ptpn14 UTSW 1 189865512 missense probably benign 0.00
R1840:Ptpn14 UTSW 1 189786851 missense probably damaging 1.00
R1845:Ptpn14 UTSW 1 189839502 missense possibly damaging 0.96
R1891:Ptpn14 UTSW 1 189798653 missense probably damaging 1.00
R2187:Ptpn14 UTSW 1 189863228 nonsense probably null
R2288:Ptpn14 UTSW 1 189865498 missense probably damaging 1.00
R3686:Ptpn14 UTSW 1 189851399 missense probably damaging 1.00
R3898:Ptpn14 UTSW 1 189850531 missense probably benign 0.35
R4004:Ptpn14 UTSW 1 189850510 missense probably benign 0.00
R4816:Ptpn14 UTSW 1 189856800 missense probably damaging 1.00
R4883:Ptpn14 UTSW 1 189850800 missense probably damaging 0.99
R4928:Ptpn14 UTSW 1 189822642 missense probably damaging 1.00
R4931:Ptpn14 UTSW 1 189851277 missense probably benign
R4957:Ptpn14 UTSW 1 189851272 missense probably benign 0.02
R5009:Ptpn14 UTSW 1 189850534 missense probably benign
R5038:Ptpn14 UTSW 1 189786886 missense probably damaging 1.00
R5264:Ptpn14 UTSW 1 189832800 critical splice donor site probably null
R5373:Ptpn14 UTSW 1 189850963 missense probably benign
R5441:Ptpn14 UTSW 1 189798570 missense probably damaging 1.00
R5540:Ptpn14 UTSW 1 189846364 missense probably benign 0.05
R5638:Ptpn14 UTSW 1 189786841 missense probably damaging 1.00
R5746:Ptpn14 UTSW 1 189846413 critical splice donor site probably null
R5872:Ptpn14 UTSW 1 189851032 missense probably benign 0.00
R5988:Ptpn14 UTSW 1 189850387 missense probably damaging 1.00
R6139:Ptpn14 UTSW 1 189851165 missense probably benign 0.01
R6295:Ptpn14 UTSW 1 189850800 missense probably damaging 0.99
R6770:Ptpn14 UTSW 1 189832773 missense probably damaging 1.00
R7097:Ptpn14 UTSW 1 189863398 nonsense probably null
R7320:Ptpn14 UTSW 1 189832759 missense probably benign 0.11
R7324:Ptpn14 UTSW 1 189863424 missense possibly damaging 0.46
R7599:Ptpn14 UTSW 1 189850745 missense probably benign 0.39
R7699:Ptpn14 UTSW 1 189865411 missense probably benign 0.08
R7700:Ptpn14 UTSW 1 189865411 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- GGTCTCTGCGTAACCTCAATATC -3'
(R):5'- TTACCAGATCAGGGCTGCTG -3'

Sequencing Primer
(F):5'- TCTGCGTAACCTCAATATCATCAAC -3'
(R):5'- TGCCGCTGACGTACTTG -3'
Posted On2015-04-17