Incidental Mutation 'R3895:Vps16'
ID 310484
Institutional Source Beutler Lab
Gene Symbol Vps16
Ensembl Gene ENSMUSG00000027411
Gene Name VSP16 CORVET/HOPS core subunit
Synonyms
MMRRC Submission 040806-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.971) question?
Stock # R3895 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 130424339-130444269 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 130438676 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 208 (S208P)
Ref Sequence ENSEMBL: ENSMUSP00000028900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028900] [ENSMUST00000128994]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000028900
AA Change: S208P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000028900
Gene: ENSMUSG00000027411
AA Change: S208P

DomainStartEndE-ValueType
Pfam:Vps16_N 4 420 1e-166 PFAM
low complexity region 452 462 N/A INTRINSIC
Pfam:Vps16_C 517 835 5.5e-150 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125098
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125973
Predicted Effect possibly damaging
Transcript: ENSMUST00000128994
AA Change: S208P

PolyPhen 2 Score 0.687 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000115899
Gene: ENSMUSG00000027411
AA Change: S208P

DomainStartEndE-ValueType
Pfam:Vps16_N 4 212 3.2e-74 PFAM
Pfam:Vps16_N 205 316 1e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130258
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131220
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132388
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134677
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137084
Meta Mutation Damage Score 0.0985 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 96% (45/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene encodes the human homolog of yeast class C Vps16 protein. The mammalian class C Vps proteins are predominantly associated with late endosomes/lysosomes, and like their yeast counterparts, may mediate vesicle trafficking steps in the endosome/lysosome pathway. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mice with a homozygous point mutation in exon 3 display impaired motor function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acoxl T C 2: 127,972,525 probably benign Het
C6 T C 15: 4,808,470 V854A probably benign Het
Ccnd1 T C 7: 144,937,894 E136G probably damaging Het
CK137956 A T 4: 127,946,648 F422I probably benign Het
Csta1 T C 16: 36,131,032 T7A probably benign Het
Dock8 A G 19: 25,051,501 E23G probably benign Het
Fbxo8 A T 8: 56,591,521 R286S probably damaging Het
Gm12258 T G 11: 58,858,549 Y183* probably null Het
Gm4759 T A 7: 106,423,414 H127L probably damaging Het
Hectd3 A G 4: 116,996,089 D171G probably damaging Het
Hoxd11 C T 2: 74,682,792 R134W probably damaging Het
Ighg2c T C 12: 113,287,658 T246A unknown Het
Ints6 T C 14: 62,696,611 I816V probably damaging Het
Lrp4 G A 2: 91,473,949 G158S probably damaging Het
Mast1 G A 8: 84,935,723 P52L probably damaging Het
Med13l A G 5: 118,761,323 D2148G probably null Het
Med24 A G 11: 98,706,388 S889P probably benign Het
Mgam T A 6: 40,759,120 M851K probably damaging Het
Mkln1 T A 6: 31,507,667 L710H probably damaging Het
Morf4l1 A T 9: 90,094,448 F276I possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myt1 T A 2: 181,820,070 S574R probably damaging Het
Nol11 C A 11: 107,168,347 V644F probably damaging Het
Nusap1 C A 2: 119,627,691 Q103K possibly damaging Het
Ovgp1 A G 3: 105,986,596 probably benign Het
Pcdh9 C T 14: 93,887,538 V399M probably damaging Het
Plekhh1 T C 12: 79,055,232 S359P probably benign Het
Prg4 G C 1: 150,454,759 probably benign Het
Ptpn14 C T 1: 189,850,546 A530V probably benign Het
Rho A G 6: 115,933,902 Y136C probably damaging Het
Rps3 C T 7: 99,479,896 R173H probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sall2 T C 14: 52,314,047 N564D probably damaging Het
Sart3 G A 5: 113,752,427 R452* probably null Het
Sbf2 T C 7: 110,447,091 I300V probably damaging Het
Sgo2b A T 8: 63,928,733 V355E possibly damaging Het
Slc22a5 T C 11: 53,865,825 K553R possibly damaging Het
Syne1 A G 10: 5,405,456 V375A probably damaging Het
Trafd1 T C 5: 121,378,741 E28G probably benign Het
Tsc2 T C 17: 24,599,812 K1292R probably damaging Het
Twnk A G 19: 45,007,451 T108A probably damaging Het
Unc13c A T 9: 73,933,523 H15Q probably benign Het
Other mutations in Vps16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Vps16 APN 2 130437696 missense probably benign 0.19
IGL01400:Vps16 APN 2 130438353 missense possibly damaging 0.73
IGL01542:Vps16 APN 2 130438394 missense probably damaging 0.97
IGL02011:Vps16 APN 2 130441479 missense probably benign 0.04
IGL02192:Vps16 APN 2 130440932 missense probably damaging 0.98
IGL02220:Vps16 APN 2 130441653 missense possibly damaging 0.85
IGL02587:Vps16 APN 2 130439716 critical splice donor site probably null
R0427:Vps16 UTSW 2 130438850 missense probably benign 0.00
R0507:Vps16 UTSW 2 130437712 critical splice donor site probably null
R1550:Vps16 UTSW 2 130440340 missense probably benign 0.09
R1789:Vps16 UTSW 2 130443600 missense probably benign 0.42
R3981:Vps16 UTSW 2 130442594 missense possibly damaging 0.77
R4092:Vps16 UTSW 2 130439912 missense probably damaging 1.00
R4555:Vps16 UTSW 2 130443576 missense probably damaging 1.00
R4569:Vps16 UTSW 2 130442204 missense probably benign
R4803:Vps16 UTSW 2 130438110 missense probably benign 0.27
R4835:Vps16 UTSW 2 130438300 splice site probably benign
R5022:Vps16 UTSW 2 130439452 missense probably benign 0.07
R5023:Vps16 UTSW 2 130439452 missense probably benign 0.07
R5057:Vps16 UTSW 2 130439452 missense probably benign 0.07
R5158:Vps16 UTSW 2 130441279 missense probably damaging 1.00
R5177:Vps16 UTSW 2 130443368 nonsense probably null
R5540:Vps16 UTSW 2 130442385 missense probably benign 0.00
R5680:Vps16 UTSW 2 130440324 missense possibly damaging 0.64
R5689:Vps16 UTSW 2 130439091 nonsense probably null
R5690:Vps16 UTSW 2 130439091 nonsense probably null
R5926:Vps16 UTSW 2 130443556 missense probably damaging 0.97
R5992:Vps16 UTSW 2 130424449 critical splice donor site probably null
R6135:Vps16 UTSW 2 130438653 missense possibly damaging 0.57
R6370:Vps16 UTSW 2 130443384 missense probably damaging 1.00
R6898:Vps16 UTSW 2 130437681 missense possibly damaging 0.74
R7378:Vps16 UTSW 2 130438179 missense probably damaging 1.00
R7487:Vps16 UTSW 2 130439057 nonsense probably null
R7641:Vps16 UTSW 2 130440528 missense probably benign 0.28
R7720:Vps16 UTSW 2 130441703 nonsense probably null
R8246:Vps16 UTSW 2 130438873 missense probably damaging 1.00
R8363:Vps16 UTSW 2 130442241 missense probably benign 0.08
R9092:Vps16 UTSW 2 130439673 missense probably damaging 0.99
R9128:Vps16 UTSW 2 130424399 missense possibly damaging 0.51
R9352:Vps16 UTSW 2 130441903 critical splice donor site probably null
R9406:Vps16 UTSW 2 130441505 critical splice donor site probably null
R9508:Vps16 UTSW 2 130442441 missense possibly damaging 0.94
R9800:Vps16 UTSW 2 130440485 missense probably benign 0.02
RF021:Vps16 UTSW 2 130438209 missense probably benign 0.09
Z1177:Vps16 UTSW 2 130441426 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGCCCTTCAATACCACGG -3'
(R):5'- GTGTCTGTGAAGAGTGCCAG -3'

Sequencing Primer
(F):5'- ACGGATATGCTTCCAGACTG -3'
(R):5'- TGCCAGGTAACGATACGTG -3'
Posted On 2015-04-17