Incidental Mutation 'R3895:Sart3'
ID310489
Institutional Source Beutler Lab
Gene Symbol Sart3
Ensembl Gene ENSMUSG00000018974
Gene Namesquamous cell carcinoma antigen recognized by T cells 3
Synonyms
MMRRC Submission 040806-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.972) question?
Stock #R3895 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location113742446-113772510 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 113752427 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 452 (R452*)
Ref Sequence ENSEMBL: ENSMUSP00000019118 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019118] [ENSMUST00000197041]
Predicted Effect probably null
Transcript: ENSMUST00000019118
AA Change: R452*
SMART Domains Protein: ENSMUSP00000019118
Gene: ENSMUSG00000018974
AA Change: R452*

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
low complexity region 11 33 N/A INTRINSIC
low complexity region 42 50 N/A INTRINSIC
low complexity region 65 93 N/A INTRINSIC
HAT 127 159 1.76e1 SMART
HAT 165 196 4.82e-1 SMART
HAT 202 238 1.53e-3 SMART
low complexity region 269 281 N/A INTRINSIC
HAT 325 357 1.78e-4 SMART
HAT 360 392 7.83e-1 SMART
HAT 395 431 7.56e0 SMART
HAT 488 521 7.31e-1 SMART
coiled coil region 554 619 N/A INTRINSIC
low complexity region 626 640 N/A INTRINSIC
RRM 705 778 1.87e-14 SMART
RRM 802 874 3.2e-22 SMART
Pfam:LSM_int_assoc 877 937 3.1e-28 PFAM
Pfam:Lsm_interact 944 961 2e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196738
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196778
Predicted Effect probably benign
Transcript: ENSMUST00000197041
SMART Domains Protein: ENSMUSP00000143778
Gene: ENSMUSG00000018974

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
low complexity region 11 33 N/A INTRINSIC
low complexity region 42 50 N/A INTRINSIC
low complexity region 65 93 N/A INTRINSIC
HAT 127 159 1.76e1 SMART
HAT 165 196 4.82e-1 SMART
HAT 202 238 1.53e-3 SMART
low complexity region 269 281 N/A INTRINSIC
Blast:HAT 292 323 1e-5 BLAST
HAT 325 357 1.33e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198097
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198556
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 96% (45/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an RNA-binding nuclear protein that is a tumor-rejection antigen. This antigen possesses tumor epitopes capable of inducing HLA-A24-restricted and tumor-specific cytotoxic T lymphocytes in cancer patients and may be useful for specific immunotherapy. This gene product is found to be an important cellular factor for HIV-1 gene expression and viral replication. It also associates transiently with U6 and U4/U6 snRNPs during the recycling phase of the spliceosome cycle. This encoded protein is thought to be involved in the regulation of mRNA splicing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional allele activated in hematopoietic cells exhibit protection against the effects of 5-FU treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acoxl T C 2: 127,972,525 probably benign Het
C6 T C 15: 4,808,470 V854A probably benign Het
Ccnd1 T C 7: 144,937,894 E136G probably damaging Het
CK137956 A T 4: 127,946,648 F422I probably benign Het
Csta1 T C 16: 36,131,032 T7A probably benign Het
Dock8 A G 19: 25,051,501 E23G probably benign Het
Fbxo8 A T 8: 56,591,521 R286S probably damaging Het
Gm12258 T G 11: 58,858,549 Y183* probably null Het
Gm4759 T A 7: 106,423,414 H127L probably damaging Het
Hectd3 A G 4: 116,996,089 D171G probably damaging Het
Hoxd11 C T 2: 74,682,792 R134W probably damaging Het
Ighg2c T C 12: 113,287,658 T246A unknown Het
Ints6 T C 14: 62,696,611 I816V probably damaging Het
Lrp4 G A 2: 91,473,949 G158S probably damaging Het
Mast1 G A 8: 84,935,723 P52L probably damaging Het
Med13l A G 5: 118,761,323 D2148G probably null Het
Med24 A G 11: 98,706,388 S889P probably benign Het
Mgam T A 6: 40,759,120 M851K probably damaging Het
Mkln1 T A 6: 31,507,667 L710H probably damaging Het
Morf4l1 A T 9: 90,094,448 F276I possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myt1 T A 2: 181,820,070 S574R probably damaging Het
Nol11 C A 11: 107,168,347 V644F probably damaging Het
Nusap1 C A 2: 119,627,691 Q103K possibly damaging Het
Ovgp1 A G 3: 105,986,596 probably benign Het
Pcdh9 C T 14: 93,887,538 V399M probably damaging Het
Plekhh1 T C 12: 79,055,232 S359P probably benign Het
Prg4 G C 1: 150,454,759 probably benign Het
Ptpn14 C T 1: 189,850,546 A530V probably benign Het
Rho A G 6: 115,933,902 Y136C probably damaging Het
Rps3 C T 7: 99,479,896 R173H probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sall2 T C 14: 52,314,047 N564D probably damaging Het
Sbf2 T C 7: 110,447,091 I300V probably damaging Het
Sgo2b A T 8: 63,928,733 V355E possibly damaging Het
Slc22a5 T C 11: 53,865,825 K553R possibly damaging Het
Syne1 A G 10: 5,405,456 V375A probably damaging Het
Trafd1 T C 5: 121,378,741 E28G probably benign Het
Tsc2 T C 17: 24,599,812 K1292R probably damaging Het
Twnk A G 19: 45,007,451 T108A probably damaging Het
Unc13c A T 9: 73,933,523 H15Q probably benign Het
Vps16 T C 2: 130,438,676 S208P possibly damaging Het
Other mutations in Sart3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Sart3 APN 5 113746669 missense probably benign
IGL01309:Sart3 APN 5 113759250 missense probably damaging 1.00
IGL01844:Sart3 APN 5 113745648 nonsense probably null
IGL02147:Sart3 APN 5 113762943 splice site probably benign
R0048:Sart3 UTSW 5 113755397 missense possibly damaging 0.92
R0048:Sart3 UTSW 5 113755397 missense possibly damaging 0.92
R0268:Sart3 UTSW 5 113752399 missense probably damaging 0.99
R1703:Sart3 UTSW 5 113752219 missense probably benign 0.22
R1704:Sart3 UTSW 5 113746007 missense probably benign 0.14
R1998:Sart3 UTSW 5 113747921 critical splice donor site probably null
R2142:Sart3 UTSW 5 113764093 missense probably damaging 0.97
R3893:Sart3 UTSW 5 113746636 missense probably benign 0.00
R4231:Sart3 UTSW 5 113771418 missense probably benign
R5367:Sart3 UTSW 5 113759216 splice site probably null
R5488:Sart3 UTSW 5 113771380 missense probably damaging 1.00
R5489:Sart3 UTSW 5 113771380 missense probably damaging 1.00
R5668:Sart3 UTSW 5 113745156 splice site probably null
R5903:Sart3 UTSW 5 113751239 missense probably damaging 0.98
R6046:Sart3 UTSW 5 113755446 missense probably damaging 1.00
R6173:Sart3 UTSW 5 113743206 missense probably benign 0.11
R6215:Sart3 UTSW 5 113743206 missense probably benign 0.11
R6216:Sart3 UTSW 5 113743206 missense probably benign 0.11
R6221:Sart3 UTSW 5 113743206 missense probably benign 0.11
R6222:Sart3 UTSW 5 113743206 missense probably benign 0.11
R6320:Sart3 UTSW 5 113751240 missense probably benign 0.34
R6824:Sart3 UTSW 5 113744539 splice site probably null
R6978:Sart3 UTSW 5 113745746 missense probably damaging 0.97
R7062:Sart3 UTSW 5 113745602 missense possibly damaging 0.49
R7162:Sart3 UTSW 5 113762835 missense probably damaging 1.00
R7165:Sart3 UTSW 5 113745995 missense probably benign 0.01
R7222:Sart3 UTSW 5 113746656 missense probably benign 0.01
R7235:Sart3 UTSW 5 113753642 missense probably damaging 1.00
R7237:Sart3 UTSW 5 113754246 missense possibly damaging 0.70
R7340:Sart3 UTSW 5 113744667 missense probably benign 0.02
R7580:Sart3 UTSW 5 113754379 splice site probably null
R7637:Sart3 UTSW 5 113771352 missense probably benign 0.14
R8146:Sart3 UTSW 5 113747957 missense probably damaging 0.98
R8241:Sart3 UTSW 5 113745968 missense probably benign 0.32
X0058:Sart3 UTSW 5 113745928 missense probably benign
Z1176:Sart3 UTSW 5 113745824 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGATCAGGCAGCTTGGATC -3'
(R):5'- AAATCCTGGGTCACACGCTG -3'

Sequencing Primer
(F):5'- GCAGCTTGGATCCCCACTC -3'
(R):5'- GCTTTTCAGGGCCACCGTAC -3'
Posted On2015-04-17