Incidental Mutation 'R3895:Mkln1'
ID 310492
Institutional Source Beutler Lab
Gene Symbol Mkln1
Ensembl Gene ENSMUSG00000025609
Gene Name muskelin 1, intracellular mediator containing kelch motifs
Synonyms
MMRRC Submission 040806-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.751) question?
Stock # R3895 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 31398735-31516811 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 31507667 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Histidine at position 710 (L710H)
Ref Sequence ENSEMBL: ENSMUSP00000026699 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026699] [ENSMUST00000130108]
AlphaFold O89050
PDB Structure The crystal structure of discoidin domain from muskelin [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000026699
AA Change: L710H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026699
Gene: ENSMUSG00000025609
AA Change: L710H

DomainStartEndE-ValueType
Pfam:F5_F8_type_C 20 150 5.8e-11 PFAM
LisH 172 204 4.68e-3 SMART
CTLH 206 258 5.29e-2 SMART
Pfam:Kelch_4 270 324 5.8e-7 PFAM
Pfam:Kelch_1 279 315 2.2e-8 PFAM
Pfam:Kelch_3 282 334 7.6e-13 PFAM
Pfam:Kelch_1 459 498 2.8e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130108
AA Change: S164T

PolyPhen 2 Score 0.442 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000123048
Gene: ENSMUSG00000025609
AA Change: S164T

DomainStartEndE-ValueType
SCOP:d1k3ia3 1 93 8e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149859
Meta Mutation Damage Score 0.3347 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 96% (45/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Muskelin is an intracellular protein that acts as a mediator of cell spreading and cytoskeletal responses to the extracellular matrix component thrombospondin I (MIM 188060) (Adams et al., 1998 [PubMed 9724633]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit abnormal high-frequency ripple oscillation associated with GABA receptor internalization, intracellular trafficking, and degradation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acoxl T C 2: 127,972,525 probably benign Het
C6 T C 15: 4,808,470 V854A probably benign Het
Ccnd1 T C 7: 144,937,894 E136G probably damaging Het
CK137956 A T 4: 127,946,648 F422I probably benign Het
Csta1 T C 16: 36,131,032 T7A probably benign Het
Dock8 A G 19: 25,051,501 E23G probably benign Het
Fbxo8 A T 8: 56,591,521 R286S probably damaging Het
Gm12258 T G 11: 58,858,549 Y183* probably null Het
Gm4759 T A 7: 106,423,414 H127L probably damaging Het
Hectd3 A G 4: 116,996,089 D171G probably damaging Het
Hoxd11 C T 2: 74,682,792 R134W probably damaging Het
Ighg2c T C 12: 113,287,658 T246A unknown Het
Ints6 T C 14: 62,696,611 I816V probably damaging Het
Lrp4 G A 2: 91,473,949 G158S probably damaging Het
Mast1 G A 8: 84,935,723 P52L probably damaging Het
Med13l A G 5: 118,761,323 D2148G probably null Het
Med24 A G 11: 98,706,388 S889P probably benign Het
Mgam T A 6: 40,759,120 M851K probably damaging Het
Morf4l1 A T 9: 90,094,448 F276I possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myt1 T A 2: 181,820,070 S574R probably damaging Het
Nol11 C A 11: 107,168,347 V644F probably damaging Het
Nusap1 C A 2: 119,627,691 Q103K possibly damaging Het
Ovgp1 A G 3: 105,986,596 probably benign Het
Pcdh9 C T 14: 93,887,538 V399M probably damaging Het
Plekhh1 T C 12: 79,055,232 S359P probably benign Het
Prg4 G C 1: 150,454,759 probably benign Het
Ptpn14 C T 1: 189,850,546 A530V probably benign Het
Rho A G 6: 115,933,902 Y136C probably damaging Het
Rps3 C T 7: 99,479,896 R173H probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sall2 T C 14: 52,314,047 N564D probably damaging Het
Sart3 G A 5: 113,752,427 R452* probably null Het
Sbf2 T C 7: 110,447,091 I300V probably damaging Het
Sgo2b A T 8: 63,928,733 V355E possibly damaging Het
Slc22a5 T C 11: 53,865,825 K553R possibly damaging Het
Syne1 A G 10: 5,405,456 V375A probably damaging Het
Trafd1 T C 5: 121,378,741 E28G probably benign Het
Tsc2 T C 17: 24,599,812 K1292R probably damaging Het
Twnk A G 19: 45,007,451 T108A probably damaging Het
Unc13c A T 9: 73,933,523 H15Q probably benign Het
Vps16 T C 2: 130,438,676 S208P possibly damaging Het
Other mutations in Mkln1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01138:Mkln1 APN 6 31432990 missense probably damaging 0.99
IGL01569:Mkln1 APN 6 31428128 splice site probably benign
IGL01882:Mkln1 APN 6 31451534 missense probably benign
IGL02009:Mkln1 APN 6 31449520 missense probably benign 0.02
IGL02160:Mkln1 APN 6 31492791 splice site probably benign
IGL02994:Mkln1 APN 6 31490443 missense probably damaging 1.00
IGL03105:Mkln1 APN 6 31459059 nonsense probably null
PIT4377001:Mkln1 UTSW 6 31474354 missense probably damaging 1.00
R0376:Mkln1 UTSW 6 31478018 missense probably benign 0.00
R0446:Mkln1 UTSW 6 31449504 missense probably damaging 0.98
R0518:Mkln1 UTSW 6 31468132 missense probably benign 0.00
R0600:Mkln1 UTSW 6 31432927 splice site probably benign
R1066:Mkln1 UTSW 6 31418987 missense possibly damaging 0.85
R1248:Mkln1 UTSW 6 31489368 missense probably damaging 1.00
R1717:Mkln1 UTSW 6 31507644 missense probably benign
R1921:Mkln1 UTSW 6 31428178 missense probably benign 0.22
R1978:Mkln1 UTSW 6 31490530 nonsense probably null
R3836:Mkln1 UTSW 6 31468336 missense probably damaging 1.00
R4456:Mkln1 UTSW 6 31426772 missense probably damaging 1.00
R4513:Mkln1 UTSW 6 31433158 intron probably benign
R4737:Mkln1 UTSW 6 31426799 missense probably damaging 1.00
R4819:Mkln1 UTSW 6 31474486 missense probably benign 0.00
R4960:Mkln1 UTSW 6 31459006 missense probably damaging 1.00
R5291:Mkln1 UTSW 6 31490481 missense possibly damaging 0.78
R5364:Mkln1 UTSW 6 31496712 missense probably damaging 1.00
R5739:Mkln1 UTSW 6 31496702 missense probably benign 0.00
R5797:Mkln1 UTSW 6 31433069 missense probably benign 0.21
R5890:Mkln1 UTSW 6 31490547 missense probably benign 0.02
R5940:Mkln1 UTSW 6 31489372 missense probably damaging 1.00
R6132:Mkln1 UTSW 6 31431220 missense probably damaging 0.98
R6521:Mkln1 UTSW 6 31490544 missense probably damaging 1.00
R7362:Mkln1 UTSW 6 31468168 missense probably benign 0.31
R7711:Mkln1 UTSW 6 31492649 missense probably damaging 0.99
R8094:Mkln1 UTSW 6 31492653 nonsense probably null
R8340:Mkln1 UTSW 6 31432943 missense possibly damaging 0.53
R8379:Mkln1 UTSW 6 31458965 nonsense probably null
R8972:Mkln1 UTSW 6 31496746 missense probably damaging 1.00
R9403:Mkln1 UTSW 6 31432970 missense not run
Z1176:Mkln1 UTSW 6 31398921 missense possibly damaging 0.74
Z1176:Mkln1 UTSW 6 31451554 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAGTGCCTAGTCCACACTGGC -3'
(R):5'- CCTTCAAAACTCTGGTGCCG -3'

Sequencing Primer
(F):5'- ACTGGCTAGGTCAGTGATTCTCAAC -3'
(R):5'- AAAACTCTGGTGCCGTCCTCAG -3'
Posted On 2015-04-17