Incidental Mutation 'R3895:Ighg2c'
ID310511
Institutional Source Beutler Lab
Gene Symbol Ighg2c
Ensembl Gene ENSMUSG00000076612
Gene Nameimmunoglobulin heavy constant gamma 2C
Synonyms
MMRRC Submission 040806-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R3895 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location113287285-113288932 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 113287658 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 246 (T246A)
Gene Model predicted gene model for transcript(s):
Predicted Effect unknown
Transcript: ENSMUST00000103416
AA Change: T246A
SMART Domains Protein: ENSMUSP00000100212
Gene: ENSMUSG00000076612
AA Change: T246A

DomainStartEndE-ValueType
IGc1 21 91 2.4e-15 SMART
IG_like 143 218 1.64e-2 SMART
IGc1 249 322 1.97e-34 SMART
transmembrane domain 350 372 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000195192
AA Change: T246A
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 96% (45/47)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acoxl T C 2: 127,972,525 probably benign Het
C6 T C 15: 4,808,470 V854A probably benign Het
Ccnd1 T C 7: 144,937,894 E136G probably damaging Het
CK137956 A T 4: 127,946,648 F422I probably benign Het
Csta1 T C 16: 36,131,032 T7A probably benign Het
Dock8 A G 19: 25,051,501 E23G probably benign Het
Fbxo8 A T 8: 56,591,521 R286S probably damaging Het
Gm12258 T G 11: 58,858,549 Y183* probably null Het
Gm4759 T A 7: 106,423,414 H127L probably damaging Het
Hectd3 A G 4: 116,996,089 D171G probably damaging Het
Hoxd11 C T 2: 74,682,792 R134W probably damaging Het
Ints6 T C 14: 62,696,611 I816V probably damaging Het
Lrp4 G A 2: 91,473,949 G158S probably damaging Het
Mast1 G A 8: 84,935,723 P52L probably damaging Het
Med13l A G 5: 118,761,323 D2148G probably null Het
Med24 A G 11: 98,706,388 S889P probably benign Het
Mgam T A 6: 40,759,120 M851K probably damaging Het
Mkln1 T A 6: 31,507,667 L710H probably damaging Het
Morf4l1 A T 9: 90,094,448 F276I possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myt1 T A 2: 181,820,070 S574R probably damaging Het
Nol11 C A 11: 107,168,347 V644F probably damaging Het
Nusap1 C A 2: 119,627,691 Q103K possibly damaging Het
Ovgp1 A G 3: 105,986,596 probably benign Het
Pcdh9 C T 14: 93,887,538 V399M probably damaging Het
Plekhh1 T C 12: 79,055,232 S359P probably benign Het
Prg4 G C 1: 150,454,759 probably benign Het
Ptpn14 C T 1: 189,850,546 A530V probably benign Het
Rho A G 6: 115,933,902 Y136C probably damaging Het
Rps3 C T 7: 99,479,896 R173H probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sall2 T C 14: 52,314,047 N564D probably damaging Het
Sart3 G A 5: 113,752,427 R452* probably null Het
Sbf2 T C 7: 110,447,091 I300V probably damaging Het
Sgo2b A T 8: 63,928,733 V355E possibly damaging Het
Slc22a5 T C 11: 53,865,825 K553R possibly damaging Het
Syne1 A G 10: 5,405,456 V375A probably damaging Het
Trafd1 T C 5: 121,378,741 E28G probably benign Het
Tsc2 T C 17: 24,599,812 K1292R probably damaging Het
Twnk A G 19: 45,007,451 T108A probably damaging Het
Unc13c A T 9: 73,933,523 H15Q probably benign Het
Vps16 T C 2: 130,438,676 S208P possibly damaging Het
Other mutations in Ighg2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02087:Ighg2c APN 12 113285366 unclassified probably benign
IGL02560:Ighg2c APN 12 113287884 missense unknown
IGL03339:Ighg2c APN 12 113287994 missense unknown
R0047:Ighg2c UTSW 12 113288168 splice site probably benign
R0047:Ighg2c UTSW 12 113288168 splice site probably benign
R0415:Ighg2c UTSW 12 113287910 missense unknown
R0571:Ighg2c UTSW 12 113288762 nonsense probably null
R0634:Ighg2c UTSW 12 113287964 missense unknown
R0893:Ighg2c UTSW 12 113287433 missense unknown
R1169:Ighg2c UTSW 12 113285952 unclassified probably benign
R5065:Ighg2c UTSW 12 113288088 missense unknown
R6407:Ighg2c UTSW 12 113288651 missense unknown
R6846:Ighg2c UTSW 12 113288310 missense unknown
R7052:Ighg2c UTSW 12 113288723 missense
R7231:Ighg2c UTSW 12 113288016 missense
R7513:Ighg2c UTSW 12 113288851 missense
Z1177:Ighg2c UTSW 12 113287680 missense
Predicted Primers PCR Primer
(F):5'- AAGTGCTCTTTTGTACTCTGAGC -3'
(R):5'- TGCAAGGTCAACAACAGAGC -3'

Sequencing Primer
(F):5'- ACTCTGAGCTTGCTGTACATGAAG -3'
(R):5'- GGTCAACAACAGAGCCCTCC -3'
Posted On2015-04-17