Incidental Mutation 'R3896:Atp8b2'
ID310529
Institutional Source Beutler Lab
Gene Symbol Atp8b2
Ensembl Gene ENSMUSG00000060671
Gene NameATPase, class I, type 8B, member 2
SynonymsId
MMRRC Submission 040807-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.211) question?
Stock #R3896 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location89939481-89963508 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 89957319 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 163 (I163K)
Ref Sequence ENSEMBL: ENSMUSP00000128423 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069805] [ENSMUST00000107396] [ENSMUST00000168276] [ENSMUST00000168880] [ENSMUST00000170696] [ENSMUST00000171422]
Predicted Effect probably damaging
Transcript: ENSMUST00000069805
AA Change: I182K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000063384
Gene: ENSMUSG00000060671
AA Change: I182K

DomainStartEndE-ValueType
low complexity region 30 44 N/A INTRINSIC
low complexity region 80 96 N/A INTRINSIC
Pfam:E1-E2_ATPase 103 374 5.6e-18 PFAM
Pfam:HAD 408 842 1.3e-17 PFAM
Pfam:Hydrolase_like2 491 590 1e-11 PFAM
Pfam:Hydrolase 590 845 7.9e-8 PFAM
low complexity region 1133 1147 N/A INTRINSIC
low complexity region 1167 1190 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107396
AA Change: I163K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000103019
Gene: ENSMUSG00000060671
AA Change: I163K

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 15 81 1.3e-29 PFAM
Pfam:E1-E2_ATPase 81 351 2.7e-9 PFAM
Pfam:HAD 389 847 1.5e-17 PFAM
Pfam:Cation_ATPase 472 571 4.3e-12 PFAM
Pfam:PhoLip_ATPase_C 864 1118 2e-84 PFAM
low complexity region 1138 1152 N/A INTRINSIC
low complexity region 1172 1195 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163354
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166347
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166705
Predicted Effect probably damaging
Transcript: ENSMUST00000168276
AA Change: I163K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000128423
Gene: ENSMUSG00000060671
AA Change: I163K

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
low complexity region 61 77 N/A INTRINSIC
Pfam:E1-E2_ATPase 84 355 2.5e-18 PFAM
Pfam:HAD 389 823 7.9e-18 PFAM
Pfam:Hydrolase_like2 472 571 3.6e-12 PFAM
Pfam:Hydrolase 571 826 6.5e-8 PFAM
low complexity region 1114 1128 N/A INTRINSIC
low complexity region 1148 1171 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168880
SMART Domains Protein: ENSMUSP00000128726
Gene: ENSMUSG00000060671

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
transmembrane domain 72 94 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000170696
AA Change: I35K

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000126142
Gene: ENSMUSG00000060671
AA Change: I35K

DomainStartEndE-ValueType
Pfam:E1-E2_ATPase 1 128 4.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171422
SMART Domains Protein: ENSMUSP00000129641
Gene: ENSMUSG00000060671

DomainStartEndE-ValueType
low complexity region 30 44 N/A INTRINSIC
Meta Mutation Damage Score 0.6571 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to another. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503B20Rik A T 3: 146,651,113 N13K possibly damaging Het
4931428F04Rik T A 8: 105,283,288 H343L probably benign Het
Alas1 G T 9: 106,241,801 probably null Het
Arhgap20 A T 9: 51,816,837 I117F probably damaging Het
Asz1 A G 6: 18,075,767 I269T probably benign Het
Atp8a2 C A 14: 60,026,140 probably null Het
Casd1 T A 6: 4,640,980 F700L probably damaging Het
Ccdc80 A G 16: 45,096,621 D580G probably benign Het
Cog7 C T 7: 121,941,169 probably benign Het
Cyp2c66 T C 19: 39,142,278 V112A possibly damaging Het
D130040H23Rik T A 8: 69,302,958 C356S probably damaging Het
Emb A G 13: 117,273,062 *331W probably null Het
Enpp3 A C 10: 24,777,949 S703R possibly damaging Het
Fam13b T C 18: 34,462,955 probably benign Het
Foxp1 T A 6: 99,075,936 Q97L probably benign Het
Gdf10 A T 14: 33,934,481 N467Y probably damaging Het
Gm29394 C T 15: 58,048,628 probably benign Het
Gsn T C 2: 35,302,638 S522P possibly damaging Het
Hydin T A 8: 110,509,079 F1899I possibly damaging Het
Ints1 C A 5: 139,757,644 E1658* probably null Het
Jakmip2 A T 18: 43,549,686 F691Y probably benign Het
Klhl28 A G 12: 64,957,559 F60S probably damaging Het
Loxhd1 C T 18: 77,382,023 S992L possibly damaging Het
Lrp1b A T 2: 40,922,428 probably null Het
Macf1 A T 4: 123,471,194 I3258N possibly damaging Het
Map4k2 G T 19: 6,341,928 E91* probably null Het
Myo1b A T 1: 51,773,261 V739E probably damaging Het
Naa35 C T 13: 59,607,295 T185I probably damaging Het
Olfr1229 A G 2: 89,283,097 F33S possibly damaging Het
Olfr1418 T C 19: 11,855,587 D122G probably damaging Het
Reg4 A T 3: 98,224,766 probably benign Het
Rnaseh2b A C 14: 62,360,457 probably benign Het
Rnf123 G A 9: 108,069,103 probably benign Het
Scn8a A T 15: 101,035,498 M1528L probably benign Het
Sdr16c5 T A 4: 4,006,609 T228S probably damaging Het
Sgo2a T C 1: 58,013,646 C202R probably damaging Het
Slc25a46 A G 18: 31,583,672 L259P probably damaging Het
Slc4a4 A G 5: 89,197,766 probably benign Het
Sox14 G T 9: 99,875,583 H34Q probably damaging Het
Syna T A 5: 134,558,311 K595* probably null Het
Taf4 A G 2: 179,932,014 V687A probably benign Het
Tmbim7 C T 5: 3,661,916 H54Y probably benign Het
Vmn1r212 T C 13: 22,883,897 M89V probably benign Het
Vmn1r86 T C 7: 13,102,166 Y261C probably benign Het
Xkr4 A G 1: 3,216,191 I592T probably damaging Het
Ywhah A G 5: 33,027,005 Y184C probably damaging Het
Zkscan16 C T 4: 58,946,125 probably benign Het
Other mutations in Atp8b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02313:Atp8b2 APN 3 89949853 missense probably damaging 1.00
IGL02472:Atp8b2 APN 3 89954239 missense probably damaging 1.00
IGL02651:Atp8b2 APN 3 89954589 unclassified probably null
IGL03057:Atp8b2 APN 3 89944186 missense probably damaging 1.00
IGL03349:Atp8b2 APN 3 89957817 missense probably damaging 1.00
IGL03382:Atp8b2 APN 3 89948521 missense probably benign 0.00
R0550:Atp8b2 UTSW 3 89959061 splice site probably benign
R0784:Atp8b2 UTSW 3 89957073 missense probably damaging 0.99
R1249:Atp8b2 UTSW 3 89947804 missense possibly damaging 0.77
R1447:Atp8b2 UTSW 3 89944170 missense probably damaging 1.00
R1568:Atp8b2 UTSW 3 89949848 missense probably damaging 0.98
R1647:Atp8b2 UTSW 3 89941784 missense probably benign 0.30
R1736:Atp8b2 UTSW 3 89952694 missense probably damaging 0.98
R1907:Atp8b2 UTSW 3 89946276 missense probably benign 0.28
R2656:Atp8b2 UTSW 3 89941758 missense probably benign 0.05
R2888:Atp8b2 UTSW 3 89958293 missense probably damaging 1.00
R3706:Atp8b2 UTSW 3 89945152 missense probably damaging 0.99
R3708:Atp8b2 UTSW 3 89945152 missense probably damaging 0.99
R3740:Atp8b2 UTSW 3 89946031 missense probably benign
R3741:Atp8b2 UTSW 3 89946031 missense probably benign
R3742:Atp8b2 UTSW 3 89946031 missense probably benign
R3914:Atp8b2 UTSW 3 89954448 missense probably damaging 0.98
R4536:Atp8b2 UTSW 3 89941784 missense probably benign 0.30
R4770:Atp8b2 UTSW 3 89957067 missense probably damaging 0.97
R4859:Atp8b2 UTSW 3 89945980 missense probably benign
R4905:Atp8b2 UTSW 3 89949008 missense probably benign
R4925:Atp8b2 UTSW 3 89946623 critical splice donor site probably null
R4955:Atp8b2 UTSW 3 89952920 unclassified probably benign
R5433:Atp8b2 UTSW 3 89952909 unclassified probably benign
R5458:Atp8b2 UTSW 3 89946022 missense probably benign 0.00
R5517:Atp8b2 UTSW 3 89946031 missense probably benign
R5663:Atp8b2 UTSW 3 89941794 missense probably benign 0.19
R6056:Atp8b2 UTSW 3 89946221 missense possibly damaging 0.79
R6821:Atp8b2 UTSW 3 89948173 missense probably damaging 0.99
R7069:Atp8b2 UTSW 3 89954571 missense probably damaging 1.00
R7178:Atp8b2 UTSW 3 89943672 missense possibly damaging 0.88
R7533:Atp8b2 UTSW 3 89945524 missense
R7552:Atp8b2 UTSW 3 89946764 missense probably damaging 1.00
Z1088:Atp8b2 UTSW 3 89954568 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTCTCTCTGGAAGAACAACC -3'
(R):5'- GGAAACCTGTGTTTACTGGAGG -3'

Sequencing Primer
(F):5'- AACCAATAGTCTTGAGTCCTGC -3'
(R):5'- AGACTTTCTGTGTAGGCG -3'
Posted On2015-04-17