Incidental Mutation 'R3896:4930503B20Rik'
ID310531
Institutional Source Beutler Lab
Gene Symbol 4930503B20Rik
Ensembl Gene ENSMUSG00000090202
Gene NameRIKEN cDNA 4930503B20 gene
Synonyms
MMRRC Submission 040807-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R3896 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location146645193-146651317 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 146651113 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 13 (N13K)
Ref Sequence ENSEMBL: ENSMUSP00000051453 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049703] [ENSMUST00000124931] [ENSMUST00000125965] [ENSMUST00000147113] [ENSMUST00000149825] [ENSMUST00000197989]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049703
AA Change: N13K

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000051453
Gene: ENSMUSG00000090202
AA Change: N13K

DomainStartEndE-ValueType
DnaJ 2 61 1.21e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124931
SMART Domains Protein: ENSMUSP00000118464
Gene: ENSMUSG00000048652

DomainStartEndE-ValueType
SAM 28 94 3.66e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125965
SMART Domains Protein: ENSMUSP00000119608
Gene: ENSMUSG00000048652

DomainStartEndE-ValueType
SAM 28 94 3.66e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126930
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141199
Predicted Effect probably benign
Transcript: ENSMUST00000147113
SMART Domains Protein: ENSMUSP00000118934
Gene: ENSMUSG00000048652

DomainStartEndE-ValueType
SAM 28 94 3.66e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000149825
AA Change: N13K

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000114745
Gene: ENSMUSG00000090202
AA Change: N13K

DomainStartEndE-ValueType
DnaJ 2 61 1.21e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154128
Predicted Effect probably benign
Transcript: ENSMUST00000197989
SMART Domains Protein: ENSMUSP00000143496
Gene: ENSMUSG00000048652

DomainStartEndE-ValueType
SAM 9 75 2.2e-4 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931428F04Rik T A 8: 105,283,288 H343L probably benign Het
Alas1 G T 9: 106,241,801 probably null Het
Arhgap20 A T 9: 51,816,837 I117F probably damaging Het
Asz1 A G 6: 18,075,767 I269T probably benign Het
Atp8a2 C A 14: 60,026,140 probably null Het
Atp8b2 A T 3: 89,957,319 I163K probably damaging Het
Casd1 T A 6: 4,640,980 F700L probably damaging Het
Ccdc80 A G 16: 45,096,621 D580G probably benign Het
Cog7 C T 7: 121,941,169 probably benign Het
Cyp2c66 T C 19: 39,142,278 V112A possibly damaging Het
D130040H23Rik T A 8: 69,302,958 C356S probably damaging Het
Emb A G 13: 117,273,062 *331W probably null Het
Enpp3 A C 10: 24,777,949 S703R possibly damaging Het
Fam13b T C 18: 34,462,955 probably benign Het
Foxp1 T A 6: 99,075,936 Q97L probably benign Het
Gdf10 A T 14: 33,934,481 N467Y probably damaging Het
Gm29394 C T 15: 58,048,628 probably benign Het
Gsn T C 2: 35,302,638 S522P possibly damaging Het
Hydin T A 8: 110,509,079 F1899I possibly damaging Het
Ints1 C A 5: 139,757,644 E1658* probably null Het
Jakmip2 A T 18: 43,549,686 F691Y probably benign Het
Klhl28 A G 12: 64,957,559 F60S probably damaging Het
Loxhd1 C T 18: 77,382,023 S992L possibly damaging Het
Lrp1b A T 2: 40,922,428 probably null Het
Macf1 A T 4: 123,471,194 I3258N possibly damaging Het
Map4k2 G T 19: 6,341,928 E91* probably null Het
Myo1b A T 1: 51,773,261 V739E probably damaging Het
Naa35 C T 13: 59,607,295 T185I probably damaging Het
Olfr1229 A G 2: 89,283,097 F33S possibly damaging Het
Olfr1418 T C 19: 11,855,587 D122G probably damaging Het
Reg4 A T 3: 98,224,766 probably benign Het
Rnaseh2b A C 14: 62,360,457 probably benign Het
Rnf123 G A 9: 108,069,103 probably benign Het
Scn8a A T 15: 101,035,498 M1528L probably benign Het
Sdr16c5 T A 4: 4,006,609 T228S probably damaging Het
Sgo2a T C 1: 58,013,646 C202R probably damaging Het
Slc25a46 A G 18: 31,583,672 L259P probably damaging Het
Slc4a4 A G 5: 89,197,766 probably benign Het
Sox14 G T 9: 99,875,583 H34Q probably damaging Het
Syna T A 5: 134,558,311 K595* probably null Het
Taf4 A G 2: 179,932,014 V687A probably benign Het
Tmbim7 C T 5: 3,661,916 H54Y probably benign Het
Vmn1r212 T C 13: 22,883,897 M89V probably benign Het
Vmn1r86 T C 7: 13,102,166 Y261C probably benign Het
Xkr4 A G 1: 3,216,191 I592T probably damaging Het
Ywhah A G 5: 33,027,005 Y184C probably damaging Het
Zkscan16 C T 4: 58,946,125 probably benign Het
Other mutations in 4930503B20Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0211:4930503B20Rik UTSW 3 146650496 missense probably benign
R1131:4930503B20Rik UTSW 3 146651082 missense probably damaging 1.00
R1523:4930503B20Rik UTSW 3 146651109 missense probably damaging 1.00
R2281:4930503B20Rik UTSW 3 146646424 missense probably damaging 0.99
R2520:4930503B20Rik UTSW 3 146650506 missense probably damaging 0.99
R4300:4930503B20Rik UTSW 3 146650920 nonsense probably null
R5196:4930503B20Rik UTSW 3 146646263 utr 3 prime probably benign
R5394:4930503B20Rik UTSW 3 146650608 missense probably damaging 1.00
R5394:4930503B20Rik UTSW 3 146650958 missense probably damaging 1.00
R5645:4930503B20Rik UTSW 3 146650509 missense probably damaging 0.98
R5894:4930503B20Rik UTSW 3 146650925 missense probably benign 0.40
R6574:4930503B20Rik UTSW 3 146650858 missense probably benign 0.02
R6830:4930503B20Rik UTSW 3 146650961 missense possibly damaging 0.90
R7604:4930503B20Rik UTSW 3 146650660 nonsense probably null
Z1176:4930503B20Rik UTSW 3 146650956 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTTCGGTTCCATCGGGAC -3'
(R):5'- TGAAGGTTCAATTCGCTGAAGAG -3'

Sequencing Primer
(F):5'- ATCGGGACCTGTCGTAATCC -3'
(R):5'- TCGCTGAAGAGGAATTTCTCC -3'
Posted On2015-04-17