Incidental Mutation 'R3896:Sdr16c5'
ID310532
Institutional Source Beutler Lab
Gene Symbol Sdr16c5
Ensembl Gene ENSMUSG00000028236
Gene Nameshort chain dehydrogenase/reductase family 16C, member 5
SynonymsRdhe2, Scdr9
MMRRC Submission 040807-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R3896 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location3995936-4019663 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 4006609 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 228 (T228S)
Ref Sequence ENSEMBL: ENSMUSP00000046298 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040925]
Predicted Effect probably damaging
Transcript: ENSMUST00000040925
AA Change: T228S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046298
Gene: ENSMUSG00000028236
AA Change: T228S

DomainStartEndE-ValueType
Pfam:KR 41 233 1.8e-17 PFAM
Pfam:adh_short 41 238 1.7e-48 PFAM
Pfam:adh_short_C2 47 228 1.3e-12 PFAM
Meta Mutation Damage Score 0.7717 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the short-chain alcohol dehydrogenase/reductase superfamily of proteins and is involved in the oxidation of retinol to retinaldehyde. The encoded protein is associated with the endoplasmic reticulum and is predicted to contain three transmembrane helices, suggesting that it is an integral membrane protein. It recognizes all-trans-retinol and all-trans-retinaldehyde as substrates and exhibits a strong preference for NAD(+)/NADH as cofactors. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503B20Rik A T 3: 146,651,113 N13K possibly damaging Het
4931428F04Rik T A 8: 105,283,288 H343L probably benign Het
Alas1 G T 9: 106,241,801 probably null Het
Arhgap20 A T 9: 51,816,837 I117F probably damaging Het
Asz1 A G 6: 18,075,767 I269T probably benign Het
Atp8a2 C A 14: 60,026,140 probably null Het
Atp8b2 A T 3: 89,957,319 I163K probably damaging Het
Casd1 T A 6: 4,640,980 F700L probably damaging Het
Ccdc80 A G 16: 45,096,621 D580G probably benign Het
Cog7 C T 7: 121,941,169 probably benign Het
Cyp2c66 T C 19: 39,142,278 V112A possibly damaging Het
D130040H23Rik T A 8: 69,302,958 C356S probably damaging Het
Emb A G 13: 117,273,062 *331W probably null Het
Enpp3 A C 10: 24,777,949 S703R possibly damaging Het
Fam13b T C 18: 34,462,955 probably benign Het
Foxp1 T A 6: 99,075,936 Q97L probably benign Het
Gdf10 A T 14: 33,934,481 N467Y probably damaging Het
Gm29394 C T 15: 58,048,628 probably benign Het
Gsn T C 2: 35,302,638 S522P possibly damaging Het
Hydin T A 8: 110,509,079 F1899I possibly damaging Het
Ints1 C A 5: 139,757,644 E1658* probably null Het
Jakmip2 A T 18: 43,549,686 F691Y probably benign Het
Klhl28 A G 12: 64,957,559 F60S probably damaging Het
Loxhd1 C T 18: 77,382,023 S992L possibly damaging Het
Lrp1b A T 2: 40,922,428 probably null Het
Macf1 A T 4: 123,471,194 I3258N possibly damaging Het
Map4k2 G T 19: 6,341,928 E91* probably null Het
Myo1b A T 1: 51,773,261 V739E probably damaging Het
Naa35 C T 13: 59,607,295 T185I probably damaging Het
Olfr1229 A G 2: 89,283,097 F33S possibly damaging Het
Olfr1418 T C 19: 11,855,587 D122G probably damaging Het
Reg4 A T 3: 98,224,766 probably benign Het
Rnaseh2b A C 14: 62,360,457 probably benign Het
Rnf123 G A 9: 108,069,103 probably benign Het
Scn8a A T 15: 101,035,498 M1528L probably benign Het
Sgo2a T C 1: 58,013,646 C202R probably damaging Het
Slc25a46 A G 18: 31,583,672 L259P probably damaging Het
Slc4a4 A G 5: 89,197,766 probably benign Het
Sox14 G T 9: 99,875,583 H34Q probably damaging Het
Syna T A 5: 134,558,311 K595* probably null Het
Taf4 A G 2: 179,932,014 V687A probably benign Het
Tmbim7 C T 5: 3,661,916 H54Y probably benign Het
Vmn1r212 T C 13: 22,883,897 M89V probably benign Het
Vmn1r86 T C 7: 13,102,166 Y261C probably benign Het
Xkr4 A G 1: 3,216,191 I592T probably damaging Het
Ywhah A G 5: 33,027,005 Y184C probably damaging Het
Zkscan16 C T 4: 58,946,125 probably benign Het
Other mutations in Sdr16c5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Sdr16c5 APN 4 4012320 splice site probably benign
IGL02230:Sdr16c5 APN 4 4016354 missense probably damaging 0.99
IGL03090:Sdr16c5 APN 4 4006575 splice site probably benign
PIT4802001:Sdr16c5 UTSW 4 4012423 missense probably damaging 1.00
R0377:Sdr16c5 UTSW 4 4005546 missense probably benign 0.03
R0610:Sdr16c5 UTSW 4 4016116 missense possibly damaging 0.81
R2012:Sdr16c5 UTSW 4 3996244 missense probably benign
R3735:Sdr16c5 UTSW 4 4005614 missense probably benign
R3839:Sdr16c5 UTSW 4 4006601 missense probably damaging 0.96
R4824:Sdr16c5 UTSW 4 4016216 nonsense probably null
R5024:Sdr16c5 UTSW 4 4010365 missense probably damaging 1.00
R5194:Sdr16c5 UTSW 4 4006663 missense probably benign 0.16
R5395:Sdr16c5 UTSW 4 4016277 missense probably benign 0.12
R6267:Sdr16c5 UTSW 4 4016162 missense probably damaging 1.00
R6352:Sdr16c5 UTSW 4 4016421 missense probably benign 0.00
R7076:Sdr16c5 UTSW 4 4006591 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCAATCAGGTCCTTAAACACACATG -3'
(R):5'- GAGACCAGTCAGACCTGAAC -3'

Sequencing Primer
(F):5'- CACACATGTGTCAGGGACAGTTC -3'
(R):5'- GTCAGACCTGAACACTTTAGCTC -3'
Posted On2015-04-17