Incidental Mutation 'R3896:Foxp1'
ID310542
Institutional Source Beutler Lab
Gene Symbol Foxp1
Ensembl Gene ENSMUSG00000030067
Gene Nameforkhead box P1
Synonyms4932443N09Rik, 3110052D19Rik
MMRRC Submission 040807-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3896 (G1)
Quality Score203
Status Validated
Chromosome6
Chromosomal Location98925338-99522721 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 99075936 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 97 (Q97L)
Ref Sequence ENSEMBL: ENSMUSP00000135764 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074346] [ENSMUST00000113322] [ENSMUST00000113324] [ENSMUST00000113326] [ENSMUST00000113328] [ENSMUST00000113329] [ENSMUST00000175886] [ENSMUST00000176565] [ENSMUST00000176632] [ENSMUST00000176850] [ENSMUST00000177208] [ENSMUST00000177230] [ENSMUST00000177307]
Predicted Effect probably benign
Transcript: ENSMUST00000074346
AA Change: Q97L

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000073953
Gene: ENSMUSG00000030067
AA Change: Q97L

DomainStartEndE-ValueType
coiled coil region 62 113 N/A INTRINSIC
low complexity region 140 191 N/A INTRINSIC
low complexity region 200 233 N/A INTRINSIC
low complexity region 236 250 N/A INTRINSIC
low complexity region 264 275 N/A INTRINSIC
low complexity region 317 330 N/A INTRINSIC
ZnF_C2H2 334 359 8.67e-1 SMART
low complexity region 371 383 N/A INTRINSIC
low complexity region 432 446 N/A INTRINSIC
FH 491 572 2.07e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113322
AA Change: Q97L

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000108948
Gene: ENSMUSG00000030067
AA Change: Q97L

DomainStartEndE-ValueType
coiled coil region 62 113 N/A INTRINSIC
low complexity region 140 191 N/A INTRINSIC
low complexity region 200 233 N/A INTRINSIC
low complexity region 236 250 N/A INTRINSIC
low complexity region 264 275 N/A INTRINSIC
low complexity region 317 330 N/A INTRINSIC
ZnF_C2H2 334 359 8.67e-1 SMART
low complexity region 371 383 N/A INTRINSIC
low complexity region 432 446 N/A INTRINSIC
FH 491 572 2.07e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113324
AA Change: Q97L

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000108950
Gene: ENSMUSG00000030067
AA Change: Q97L

DomainStartEndE-ValueType
coiled coil region 62 113 N/A INTRINSIC
low complexity region 140 192 N/A INTRINSIC
low complexity region 201 234 N/A INTRINSIC
low complexity region 237 251 N/A INTRINSIC
low complexity region 265 276 N/A INTRINSIC
low complexity region 318 331 N/A INTRINSIC
ZnF_C2H2 335 360 8.67e-1 SMART
low complexity region 372 384 N/A INTRINSIC
low complexity region 433 447 N/A INTRINSIC
FH 492 573 2.07e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113326
AA Change: Q65L

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000108952
Gene: ENSMUSG00000030067
AA Change: Q65L

DomainStartEndE-ValueType
low complexity region 108 159 N/A INTRINSIC
low complexity region 168 201 N/A INTRINSIC
low complexity region 204 218 N/A INTRINSIC
low complexity region 232 243 N/A INTRINSIC
low complexity region 285 298 N/A INTRINSIC
ZnF_C2H2 302 327 8.67e-1 SMART
low complexity region 339 351 N/A INTRINSIC
low complexity region 400 414 N/A INTRINSIC
FH 459 540 2.07e-39 SMART
Predicted Effect unknown
Transcript: ENSMUST00000113328
AA Change: Q97L
SMART Domains Protein: ENSMUSP00000108954
Gene: ENSMUSG00000030067
AA Change: Q97L

DomainStartEndE-ValueType
coiled coil region 62 113 N/A INTRINSIC
low complexity region 140 191 N/A INTRINSIC
low complexity region 200 234 N/A INTRINSIC
low complexity region 237 251 N/A INTRINSIC
low complexity region 265 276 N/A INTRINSIC
low complexity region 318 331 N/A INTRINSIC
ZnF_C2H2 335 360 8.67e-1 SMART
low complexity region 372 384 N/A INTRINSIC
low complexity region 433 447 N/A INTRINSIC
FH 492 573 2.07e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113329
AA Change: Q97L

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000108955
Gene: ENSMUSG00000030067
AA Change: Q97L

DomainStartEndE-ValueType
coiled coil region 62 113 N/A INTRINSIC
low complexity region 140 191 N/A INTRINSIC
low complexity region 200 233 N/A INTRINSIC
low complexity region 236 250 N/A INTRINSIC
low complexity region 264 275 N/A INTRINSIC
low complexity region 317 330 N/A INTRINSIC
ZnF_C2H2 334 359 8.67e-1 SMART
low complexity region 371 383 N/A INTRINSIC
low complexity region 432 446 N/A INTRINSIC
FH 491 579 1.76e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000175886
SMART Domains Protein: ENSMUSP00000135517
Gene: ENSMUSG00000030067

DomainStartEndE-ValueType
low complexity region 10 62 N/A INTRINSIC
low complexity region 71 105 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176565
AA Change: Q97L

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000135181
Gene: ENSMUSG00000030067
AA Change: Q97L

DomainStartEndE-ValueType
coiled coil region 62 113 N/A INTRINSIC
low complexity region 140 191 N/A INTRINSIC
low complexity region 200 234 N/A INTRINSIC
low complexity region 237 251 N/A INTRINSIC
low complexity region 265 276 N/A INTRINSIC
low complexity region 318 331 N/A INTRINSIC
ZnF_C2H2 335 360 8.67e-1 SMART
low complexity region 372 384 N/A INTRINSIC
low complexity region 433 447 N/A INTRINSIC
FH 491 572 2.07e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176632
AA Change: Q65L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000135635
Gene: ENSMUSG00000030067
AA Change: Q65L

DomainStartEndE-ValueType
low complexity region 108 159 N/A INTRINSIC
low complexity region 168 202 N/A INTRINSIC
low complexity region 205 219 N/A INTRINSIC
low complexity region 233 244 N/A INTRINSIC
low complexity region 286 299 N/A INTRINSIC
ZnF_C2H2 303 328 8.67e-1 SMART
low complexity region 340 352 N/A INTRINSIC
low complexity region 401 415 N/A INTRINSIC
FH 460 541 2.07e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176850
AA Change: Q65L

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000135041
Gene: ENSMUSG00000030067
AA Change: Q65L

DomainStartEndE-ValueType
low complexity region 108 160 N/A INTRINSIC
low complexity region 169 203 N/A INTRINSIC
low complexity region 206 220 N/A INTRINSIC
low complexity region 234 245 N/A INTRINSIC
low complexity region 287 300 N/A INTRINSIC
ZnF_C2H2 304 329 8.67e-1 SMART
low complexity region 341 353 N/A INTRINSIC
low complexity region 402 416 N/A INTRINSIC
FH 461 542 2.07e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177208
SMART Domains Protein: ENSMUSP00000135187
Gene: ENSMUSG00000030067

DomainStartEndE-ValueType
coiled coil region 62 88 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177230
AA Change: Q65L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000135098
Gene: ENSMUSG00000030067
AA Change: Q65L

DomainStartEndE-ValueType
low complexity region 108 160 N/A INTRINSIC
low complexity region 169 203 N/A INTRINSIC
low complexity region 206 220 N/A INTRINSIC
low complexity region 234 245 N/A INTRINSIC
low complexity region 287 300 N/A INTRINSIC
ZnF_C2H2 304 329 8.67e-1 SMART
low complexity region 341 353 N/A INTRINSIC
low complexity region 402 416 N/A INTRINSIC
FH 461 542 2.07e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177307
AA Change: Q97L

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000135764
Gene: ENSMUSG00000030067
AA Change: Q97L

DomainStartEndE-ValueType
coiled coil region 62 113 N/A INTRINSIC
low complexity region 140 192 N/A INTRINSIC
low complexity region 201 235 N/A INTRINSIC
low complexity region 238 252 N/A INTRINSIC
low complexity region 266 277 N/A INTRINSIC
low complexity region 319 332 N/A INTRINSIC
ZnF_C2H2 336 361 8.67e-1 SMART
low complexity region 373 385 N/A INTRINSIC
low complexity region 434 448 N/A INTRINSIC
FH 492 573 2.07e-39 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200105
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (48/48)
MGI Phenotype PHENOTYPE: Homozygous null mice display embryonic lethality with abnormal outflow tract septation, ventricular septal defects, abnormal cardiac valve morphology, decreased and irregular heart rate, thin ventricular compact zone, and edema. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503B20Rik A T 3: 146,651,113 N13K possibly damaging Het
4931428F04Rik T A 8: 105,283,288 H343L probably benign Het
Alas1 G T 9: 106,241,801 probably null Het
Arhgap20 A T 9: 51,816,837 I117F probably damaging Het
Asz1 A G 6: 18,075,767 I269T probably benign Het
Atp8a2 C A 14: 60,026,140 probably null Het
Atp8b2 A T 3: 89,957,319 I163K probably damaging Het
Casd1 T A 6: 4,640,980 F700L probably damaging Het
Ccdc80 A G 16: 45,096,621 D580G probably benign Het
Cog7 C T 7: 121,941,169 probably benign Het
Cyp2c66 T C 19: 39,142,278 V112A possibly damaging Het
D130040H23Rik T A 8: 69,302,958 C356S probably damaging Het
Emb A G 13: 117,273,062 *331W probably null Het
Enpp3 A C 10: 24,777,949 S703R possibly damaging Het
Fam13b T C 18: 34,462,955 probably benign Het
Gdf10 A T 14: 33,934,481 N467Y probably damaging Het
Gm29394 C T 15: 58,048,628 probably benign Het
Gsn T C 2: 35,302,638 S522P possibly damaging Het
Hydin T A 8: 110,509,079 F1899I possibly damaging Het
Ints1 C A 5: 139,757,644 E1658* probably null Het
Jakmip2 A T 18: 43,549,686 F691Y probably benign Het
Klhl28 A G 12: 64,957,559 F60S probably damaging Het
Loxhd1 C T 18: 77,382,023 S992L possibly damaging Het
Lrp1b A T 2: 40,922,428 probably null Het
Macf1 A T 4: 123,471,194 I3258N possibly damaging Het
Map4k2 G T 19: 6,341,928 E91* probably null Het
Myo1b A T 1: 51,773,261 V739E probably damaging Het
Naa35 C T 13: 59,607,295 T185I probably damaging Het
Olfr1229 A G 2: 89,283,097 F33S possibly damaging Het
Olfr1418 T C 19: 11,855,587 D122G probably damaging Het
Reg4 A T 3: 98,224,766 probably benign Het
Rnaseh2b A C 14: 62,360,457 probably benign Het
Rnf123 G A 9: 108,069,103 probably benign Het
Scn8a A T 15: 101,035,498 M1528L probably benign Het
Sdr16c5 T A 4: 4,006,609 T228S probably damaging Het
Sgo2a T C 1: 58,013,646 C202R probably damaging Het
Slc25a46 A G 18: 31,583,672 L259P probably damaging Het
Slc4a4 A G 5: 89,197,766 probably benign Het
Sox14 G T 9: 99,875,583 H34Q probably damaging Het
Syna T A 5: 134,558,311 K595* probably null Het
Taf4 A G 2: 179,932,014 V687A probably benign Het
Tmbim7 C T 5: 3,661,916 H54Y probably benign Het
Vmn1r212 T C 13: 22,883,897 M89V probably benign Het
Vmn1r86 T C 7: 13,102,166 Y261C probably benign Het
Xkr4 A G 1: 3,216,191 I592T probably damaging Het
Ywhah A G 5: 33,027,005 Y184C probably damaging Het
Zkscan16 C T 4: 58,946,125 probably benign Het
Other mutations in Foxp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02191:Foxp1 APN 6 98945600 missense probably damaging 0.99
IGL02330:Foxp1 APN 6 98945412 missense probably damaging 1.00
IGL02869:Foxp1 APN 6 98930083 utr 3 prime probably benign
IGL02968:Foxp1 APN 6 99075861 missense probably damaging 1.00
Foxy UTSW 6 99015510 nonsense probably null
Moxie UTSW 6 99015514 critical splice acceptor site probably null
R0037:Foxp1 UTSW 6 99162969 missense probably damaging 1.00
R0063:Foxp1 UTSW 6 98944723 splice site probably benign
R0063:Foxp1 UTSW 6 98944723 splice site probably benign
R0427:Foxp1 UTSW 6 98930203 missense probably damaging 1.00
R0601:Foxp1 UTSW 6 98930122 missense probably damaging 1.00
R1356:Foxp1 UTSW 6 99016676 splice site probably benign
R1468:Foxp1 UTSW 6 98978220 missense possibly damaging 0.62
R1468:Foxp1 UTSW 6 98978220 missense possibly damaging 0.62
R1548:Foxp1 UTSW 6 98945420 missense probably damaging 1.00
R1696:Foxp1 UTSW 6 98945702 missense probably benign 0.18
R1933:Foxp1 UTSW 6 99075965 small deletion probably benign
R2152:Foxp1 UTSW 6 99016541 missense probably damaging 0.99
R2338:Foxp1 UTSW 6 99003293 missense possibly damaging 0.61
R5006:Foxp1 UTSW 6 99162858 missense probably damaging 0.98
R5143:Foxp1 UTSW 6 98945532 critical splice donor site probably null
R5428:Foxp1 UTSW 6 99016631 missense probably damaging 1.00
R5765:Foxp1 UTSW 6 99015462 missense probably damaging 0.99
R5816:Foxp1 UTSW 6 99075965 small deletion probably benign
R6172:Foxp1 UTSW 6 99015510 nonsense probably null
R6172:Foxp1 UTSW 6 99015514 critical splice acceptor site probably null
R6173:Foxp1 UTSW 6 99015510 nonsense probably null
R6173:Foxp1 UTSW 6 99015514 critical splice acceptor site probably null
R6175:Foxp1 UTSW 6 98966076 missense probably damaging 1.00
R6776:Foxp1 UTSW 6 99075965 small deletion probably benign
R6782:Foxp1 UTSW 6 98930145 missense probably damaging 1.00
R7229:Foxp1 UTSW 6 98935412 missense unknown
R7559:Foxp1 UTSW 6 98945560 missense unknown
R7715:Foxp1 UTSW 6 98945660 missense unknown
X0066:Foxp1 UTSW 6 99076015 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GATGGTTTGCAATGGTCACG -3'
(R):5'- TCTTTTGCTGAGAAATGAGGAAGG -3'

Sequencing Primer
(F):5'- GATAATATCCACTTCTGCAAGGC -3'
(R):5'- TGAGATCCACTTCGTGAGGAC -3'
Posted On2015-04-17