Incidental Mutation 'R3896:Cog7'
ID310544
Institutional Source Beutler Lab
Gene Symbol Cog7
Ensembl Gene ENSMUSG00000034951
Gene Namecomponent of oligomeric golgi complex 7
Synonyms
MMRRC Submission 040807-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3896 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location121879363-121981711 bp(-) (GRCm38)
Type of Mutationcritical splice donor site
DNA Base Change (assembly) C to T at 121941169 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146193 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057576] [ENSMUST00000205438]
Predicted Effect probably benign
Transcript: ENSMUST00000057576
SMART Domains Protein: ENSMUSP00000058990
Gene: ENSMUSG00000034951

DomainStartEndE-ValueType
Pfam:COG7 2 767 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148634
Predicted Effect probably benign
Transcript: ENSMUST00000205438
Meta Mutation Damage Score 0.0941 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene resides in the golgi, and constitutes one of the 8 subunits of the conserved oligomeric Golgi (COG) complex, which is required for normal golgi morphology and localization. Mutations in this gene are associated with the congenital disorder of glycosylation type IIe.[provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503B20Rik A T 3: 146,651,113 N13K possibly damaging Het
4931428F04Rik T A 8: 105,283,288 H343L probably benign Het
Alas1 G T 9: 106,241,801 probably null Het
Arhgap20 A T 9: 51,816,837 I117F probably damaging Het
Asz1 A G 6: 18,075,767 I269T probably benign Het
Atp8a2 C A 14: 60,026,140 probably null Het
Atp8b2 A T 3: 89,957,319 I163K probably damaging Het
Casd1 T A 6: 4,640,980 F700L probably damaging Het
Ccdc80 A G 16: 45,096,621 D580G probably benign Het
Cyp2c66 T C 19: 39,142,278 V112A possibly damaging Het
D130040H23Rik T A 8: 69,302,958 C356S probably damaging Het
Emb A G 13: 117,273,062 *331W probably null Het
Enpp3 A C 10: 24,777,949 S703R possibly damaging Het
Fam13b T C 18: 34,462,955 probably benign Het
Foxp1 T A 6: 99,075,936 Q97L probably benign Het
Gdf10 A T 14: 33,934,481 N467Y probably damaging Het
Gm29394 C T 15: 58,048,628 probably benign Het
Gsn T C 2: 35,302,638 S522P possibly damaging Het
Hydin T A 8: 110,509,079 F1899I possibly damaging Het
Ints1 C A 5: 139,757,644 E1658* probably null Het
Jakmip2 A T 18: 43,549,686 F691Y probably benign Het
Klhl28 A G 12: 64,957,559 F60S probably damaging Het
Loxhd1 C T 18: 77,382,023 S992L possibly damaging Het
Lrp1b A T 2: 40,922,428 probably null Het
Macf1 A T 4: 123,471,194 I3258N possibly damaging Het
Map4k2 G T 19: 6,341,928 E91* probably null Het
Myo1b A T 1: 51,773,261 V739E probably damaging Het
Naa35 C T 13: 59,607,295 T185I probably damaging Het
Olfr1229 A G 2: 89,283,097 F33S possibly damaging Het
Olfr1418 T C 19: 11,855,587 D122G probably damaging Het
Reg4 A T 3: 98,224,766 probably benign Het
Rnaseh2b A C 14: 62,360,457 probably benign Het
Rnf123 G A 9: 108,069,103 probably benign Het
Scn8a A T 15: 101,035,498 M1528L probably benign Het
Sdr16c5 T A 4: 4,006,609 T228S probably damaging Het
Sgo2a T C 1: 58,013,646 C202R probably damaging Het
Slc25a46 A G 18: 31,583,672 L259P probably damaging Het
Slc4a4 A G 5: 89,197,766 probably benign Het
Sox14 G T 9: 99,875,583 H34Q probably damaging Het
Syna T A 5: 134,558,311 K595* probably null Het
Taf4 A G 2: 179,932,014 V687A probably benign Het
Tmbim7 C T 5: 3,661,916 H54Y probably benign Het
Vmn1r212 T C 13: 22,883,897 M89V probably benign Het
Vmn1r86 T C 7: 13,102,166 Y261C probably benign Het
Xkr4 A G 1: 3,216,191 I592T probably damaging Het
Ywhah A G 5: 33,027,005 Y184C probably damaging Het
Zkscan16 C T 4: 58,946,125 probably benign Het
Other mutations in Cog7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02023:Cog7 APN 7 121943777 critical splice donor site probably null
IGL02094:Cog7 APN 7 121963247 missense probably benign 0.21
IGL02113:Cog7 APN 7 121925480 missense probably damaging 1.00
IGL02151:Cog7 APN 7 121943808 missense probably damaging 0.97
IGL02365:Cog7 APN 7 121977736 missense possibly damaging 0.56
IGL02398:Cog7 APN 7 121964209 missense probably damaging 1.00
IGL02732:Cog7 APN 7 121923367 missense probably benign 0.05
IGL02887:Cog7 APN 7 121943844 missense possibly damaging 0.83
R0143:Cog7 UTSW 7 121951164 missense probably damaging 1.00
R0446:Cog7 UTSW 7 121937072 missense probably benign
R0521:Cog7 UTSW 7 121941169 critical splice donor site probably null
R0526:Cog7 UTSW 7 121963271 splice site probably null
R0658:Cog7 UTSW 7 121956140 splice site probably benign
R0782:Cog7 UTSW 7 121943797 missense possibly damaging 0.86
R1029:Cog7 UTSW 7 121930529 critical splice donor site probably null
R1419:Cog7 UTSW 7 121955992 missense probably damaging 0.99
R1521:Cog7 UTSW 7 121930574 missense possibly damaging 0.57
R1639:Cog7 UTSW 7 121981419 missense probably damaging 1.00
R2023:Cog7 UTSW 7 121936970 missense probably damaging 0.99
R4240:Cog7 UTSW 7 121925484 missense possibly damaging 0.50
R4731:Cog7 UTSW 7 121964244 missense probably benign 0.00
R4732:Cog7 UTSW 7 121964244 missense probably benign 0.00
R4733:Cog7 UTSW 7 121964244 missense probably benign 0.00
R4838:Cog7 UTSW 7 121971381 missense probably damaging 1.00
R5001:Cog7 UTSW 7 121949886 missense probably damaging 1.00
R5237:Cog7 UTSW 7 121951221 missense probably damaging 1.00
R5353:Cog7 UTSW 7 121941247 splice site probably null
R5609:Cog7 UTSW 7 121925460 missense probably benign 0.12
R5964:Cog7 UTSW 7 121956029 missense probably damaging 0.99
R6544:Cog7 UTSW 7 121935743 missense probably damaging 0.99
R6784:Cog7 UTSW 7 121964293 splice site probably null
R7110:Cog7 UTSW 7 121935776 missense probably damaging 0.98
R7212:Cog7 UTSW 7 121977314 missense probably damaging 0.98
R7304:Cog7 UTSW 7 121937139 missense probably benign 0.04
X0066:Cog7 UTSW 7 121977624 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTGCCAAGTAGGATAGGC -3'
(R):5'- AACATTTCAGGGAGGCAGCG -3'

Sequencing Primer
(F):5'- GCCTTGCCCTTTTAGGTGTTCAG -3'
(R):5'- AGCGTCAGAACCCAGTGC -3'
Posted On2015-04-17