Mutagenetix > Incidental Mutation

Incidental Mutation 'R3896:Rnf123'

310551

Institutional Source

Beutler Lab

Gene Symbol

Rnf123

Ensembl Gene

ENSMUSG00000041528

Gene Name

ring finger protein 123

Synonyms

KPC1

MMRRC Submission

040807-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.163) question?

Stock #

R3896 (G1)

Quality Score

185

Status

Validated

Chromosome

Chromosomal Location

107928869-107957183 bp(-) (GRCm39)

Type of Mutation

splice site

DNA Base Change (assembly)

G to A at 107946302 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000136953 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047746] [ENSMUST00000160249] [ENSMUST00000160649] [ENSMUST00000161828] [ENSMUST00000178267] [ENSMUST00000162355] [ENSMUST00000174504] [ENSMUST00000162516]

AlphaFold

Q5XPI3

Predicted Effect

probably benign
Transcript: ENSMUST00000047746

SMART Domains

Protein: ENSMUSP00000040803
Gene: ENSMUSG00000041528

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1047	1067	N/A	INTRINSIC
low complexity region	1242	1251	N/A	INTRINSIC
RING	1260	1297	5.27e-4	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159136

Predicted Effect

probably benign
Transcript: ENSMUST00000160249

SMART Domains

Protein: ENSMUSP00000124548
Gene: ENSMUSG00000041528

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1041	1061	N/A	INTRINSIC
low complexity region	1236	1245	N/A	INTRINSIC
RING	1254	1291	5.27e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000160649

SMART Domains

Protein: ENSMUSP00000125495
Gene: ENSMUSG00000041528

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1041	1061	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161673

Predicted Effect

probably benign
Transcript: ENSMUST00000161828

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162152

Predicted Effect

probably benign
Transcript: ENSMUST00000178267

SMART Domains

Protein: ENSMUSP00000136953
Gene: ENSMUSG00000041528

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1041	1061	N/A	INTRINSIC
low complexity region	1236	1245	N/A	INTRINSIC
RING	1254	1291	5.27e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000162355

SMART Domains

Protein: ENSMUSP00000125745
Gene: ENSMUSG00000041528

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1047	1067	N/A	INTRINSIC
low complexity region	1242	1251	N/A	INTRINSIC
RING	1260	1297	5.27e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000174504

Predicted Effect

probably benign
Transcript: ENSMUST00000162516

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

100% (48/48)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a C-terminal RING finger domain, a motif present in a variety of functionally distinct proteins and known to be involved in protein-protein and protein-DNA interactions, and an N-terminal SPRY domain. This protein displays E3 ubiquitin ligase activity toward the cyclin-dependent kinase inhibitor 1B which is also known as p27 or KIP1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930503B20Rik	A	T	3: 146,356,868 (GRCm39)	N13K	possibly damaging	Het
Alas1	G	T	9: 106,119,000 (GRCm39)		probably null	Het
Arhgap20	A	T	9: 51,728,137 (GRCm39)	I117F	probably damaging	Het
Asz1	A	G	6: 18,075,766 (GRCm39)	I269T	probably benign	Het
Atp8a2	C	A	14: 60,263,589 (GRCm39)		probably null	Het
Atp8b2	A	T	3: 89,864,626 (GRCm39)	I163K	probably damaging	Het
Casd1	T	A	6: 4,640,980 (GRCm39)	F700L	probably damaging	Het
Ccdc80	A	G	16: 44,916,984 (GRCm39)	D580G	probably benign	Het
Cog7	C	T	7: 121,540,392 (GRCm39)		probably benign	Het
Cyp2c66	T	C	19: 39,130,722 (GRCm39)	V112A	possibly damaging	Het
D130040H23Rik	T	A	8: 69,755,610 (GRCm39)	C356S	probably damaging	Het
Emb	A	G	13: 117,409,598 (GRCm39)	*331W	probably null	Het
Enpp3	A	C	10: 24,653,847 (GRCm39)	S703R	possibly damaging	Het
Fam13b	T	C	18: 34,596,008 (GRCm39)		probably benign	Het
Foxp1	T	A	6: 99,052,897 (GRCm39)	Q97L	probably benign	Het
Gdf10	A	T	14: 33,656,438 (GRCm39)	N467Y	probably damaging	Het
Gm29394	C	T	15: 57,912,024 (GRCm39)		probably benign	Het
Gsn	T	C	2: 35,192,650 (GRCm39)	S522P	possibly damaging	Het
Hydin	T	A	8: 111,235,711 (GRCm39)	F1899I	possibly damaging	Het
Ints1	C	A	5: 139,743,399 (GRCm39)	E1658*	probably null	Het
Jakmip2	A	T	18: 43,682,751 (GRCm39)	F691Y	probably benign	Het
Klhl28	A	G	12: 65,004,333 (GRCm39)	F60S	probably damaging	Het
Loxhd1	C	T	18: 77,469,719 (GRCm39)	S992L	possibly damaging	Het
Lrp1b	A	T	2: 40,812,440 (GRCm39)		probably null	Het
Macf1	A	T	4: 123,364,987 (GRCm39)	I3258N	possibly damaging	Het
Map4k2	G	T	19: 6,391,958 (GRCm39)	E91*	probably null	Het
Matcap1	T	A	8: 106,009,920 (GRCm39)	H343L	probably benign	Het
Myo1b	A	T	1: 51,812,420 (GRCm39)	V739E	probably damaging	Het
Naa35	C	T	13: 59,755,109 (GRCm39)	T185I	probably damaging	Het
Or10v9	T	C	19: 11,832,951 (GRCm39)	D122G	probably damaging	Het
Or4c15b	A	G	2: 89,113,441 (GRCm39)	F33S	possibly damaging	Het
Reg4	A	T	3: 98,132,082 (GRCm39)		probably benign	Het
Rnaseh2b	A	C	14: 62,597,906 (GRCm39)		probably benign	Het
Scn8a	A	T	15: 100,933,379 (GRCm39)	M1528L	probably benign	Het
Sdr16c5	T	A	4: 4,006,609 (GRCm39)	T228S	probably damaging	Het
Sgo2a	T	C	1: 58,052,805 (GRCm39)	C202R	probably damaging	Het
Slc25a46	A	G	18: 31,716,725 (GRCm39)	L259P	probably damaging	Het
Slc4a4	A	G	5: 89,345,625 (GRCm39)		probably benign	Het
Sox14	G	T	9: 99,757,636 (GRCm39)	H34Q	probably damaging	Het
Syna	T	A	5: 134,587,165 (GRCm39)	K595*	probably null	Het
Taf4	A	G	2: 179,573,807 (GRCm39)	V687A	probably benign	Het
Tmbim7	C	T	5: 3,711,916 (GRCm39)	H54Y	probably benign	Het
Vmn1r212	T	C	13: 23,068,067 (GRCm39)	M89V	probably benign	Het
Vmn1r86	T	C	7: 12,836,093 (GRCm39)	Y261C	probably benign	Het
Xkr4	A	G	1: 3,286,414 (GRCm39)	I592T	probably damaging	Het
Ywhah	A	G	5: 33,184,349 (GRCm39)	Y184C	probably damaging	Het
Zkscan16	C	T	4: 58,946,125 (GRCm39)		probably benign	Het

Other mutations in Rnf123

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00950:Rnf123	APN	9	107,944,594 (GRCm39)	critical splice donor site	probably null
IGL01358:Rnf123	APN	9	107,946,381 (GRCm39)	missense	probably damaging	1.00
IGL01464:Rnf123	APN	9	107,929,501 (GRCm39)	missense	probably damaging	1.00
IGL01637:Rnf123	APN	9	107,935,437 (GRCm39)	missense	probably damaging	1.00
IGL01669:Rnf123	APN	9	107,935,555 (GRCm39)	missense	probably damaging	0.98
IGL01905:Rnf123	APN	9	107,948,569 (GRCm39)	splice site	probably benign
IGL02070:Rnf123	APN	9	107,945,501 (GRCm39)	nonsense	probably null
IGL02072:Rnf123	APN	9	107,945,501 (GRCm39)	nonsense	probably null
IGL02073:Rnf123	APN	9	107,945,501 (GRCm39)	nonsense	probably null
IGL02074:Rnf123	APN	9	107,944,088 (GRCm39)	missense	probably damaging	1.00
IGL02079:Rnf123	APN	9	107,945,501 (GRCm39)	nonsense	probably null
IGL02080:Rnf123	APN	9	107,945,501 (GRCm39)	nonsense	probably null
IGL02231:Rnf123	APN	9	107,943,598 (GRCm39)	missense	probably benign	0.17
IGL02281:Rnf123	APN	9	107,948,651 (GRCm39)	missense	probably benign	0.01
IGL02336:Rnf123	APN	9	107,939,041 (GRCm39)	missense	probably damaging	1.00
IGL02543:Rnf123	APN	9	107,943,547 (GRCm39)	missense	probably damaging	1.00
IGL02565:Rnf123	APN	9	107,929,411 (GRCm39)	critical splice donor site	probably null
IGL02571:Rnf123	APN	9	107,945,501 (GRCm39)	nonsense	probably null
IGL02572:Rnf123	APN	9	107,945,501 (GRCm39)	nonsense	probably null
IGL02574:Rnf123	APN	9	107,945,501 (GRCm39)	nonsense	probably null
IGL02586:Rnf123	APN	9	107,945,501 (GRCm39)	nonsense	probably null
IGL02589:Rnf123	APN	9	107,945,501 (GRCm39)	nonsense	probably null
IGL02600:Rnf123	APN	9	107,945,501 (GRCm39)	nonsense	probably null
IGL02601:Rnf123	APN	9	107,945,501 (GRCm39)	nonsense	probably null
IGL02602:Rnf123	APN	9	107,945,501 (GRCm39)	nonsense	probably null
IGL02603:Rnf123	APN	9	107,945,501 (GRCm39)	nonsense	probably null
IGL02609:Rnf123	APN	9	107,945,501 (GRCm39)	nonsense	probably null
IGL02628:Rnf123	APN	9	107,945,501 (GRCm39)	nonsense	probably null
IGL02629:Rnf123	APN	9	107,947,988 (GRCm39)	splice site	probably benign
IGL02629:Rnf123	APN	9	107,945,501 (GRCm39)	nonsense	probably null
IGL02630:Rnf123	APN	9	107,945,501 (GRCm39)	nonsense	probably null
IGL02631:Rnf123	APN	9	107,945,501 (GRCm39)	nonsense	probably null
IGL02632:Rnf123	APN	9	107,945,501 (GRCm39)	nonsense	probably null
IGL02650:Rnf123	APN	9	107,946,947 (GRCm39)	missense	probably benign	0.29
IGL02690:Rnf123	APN	9	107,945,501 (GRCm39)	nonsense	probably null
IGL02691:Rnf123	APN	9	107,945,501 (GRCm39)	nonsense	probably null
IGL02692:Rnf123	APN	9	107,945,501 (GRCm39)	nonsense	probably null
IGL02693:Rnf123	APN	9	107,945,501 (GRCm39)	nonsense	probably null
IGL02713:Rnf123	APN	9	107,945,501 (GRCm39)	nonsense	probably null
IGL02736:Rnf123	APN	9	107,945,501 (GRCm39)	nonsense	probably null
IGL02929:Rnf123	APN	9	107,946,275 (GRCm39)	missense	probably benign
R1175:Rnf123	UTSW	9	107,954,572 (GRCm39)	missense	probably benign
R1465:Rnf123	UTSW	9	107,948,665 (GRCm39)	splice site	probably benign
R1502:Rnf123	UTSW	9	107,945,709 (GRCm39)	splice site	probably null
R1682:Rnf123	UTSW	9	107,954,597 (GRCm39)	missense	probably benign	0.16
R1817:Rnf123	UTSW	9	107,940,125 (GRCm39)	missense	probably benign	0.41
R1855:Rnf123	UTSW	9	107,938,990 (GRCm39)	missense	probably damaging	1.00
R2394:Rnf123	UTSW	9	107,940,735 (GRCm39)	missense	probably benign	0.00
R2483:Rnf123	UTSW	9	107,940,720 (GRCm39)	missense	probably benign	0.16
R3940:Rnf123	UTSW	9	107,941,234 (GRCm39)	splice site	probably benign
R4206:Rnf123	UTSW	9	107,941,162 (GRCm39)	missense	probably benign	0.01
R4641:Rnf123	UTSW	9	107,935,786 (GRCm39)	missense	probably damaging	1.00
R4714:Rnf123	UTSW	9	107,929,638 (GRCm39)	splice site	probably null
R4767:Rnf123	UTSW	9	107,929,288 (GRCm39)	missense	probably damaging	1.00
R4849:Rnf123	UTSW	9	107,933,290 (GRCm39)	missense	probably damaging	1.00
R4899:Rnf123	UTSW	9	107,940,879 (GRCm39)	missense	probably damaging	1.00
R5274:Rnf123	UTSW	9	107,941,202 (GRCm39)	frame shift	probably null
R5275:Rnf123	UTSW	9	107,941,202 (GRCm39)	frame shift	probably null
R5276:Rnf123	UTSW	9	107,941,202 (GRCm39)	frame shift	probably null
R5294:Rnf123	UTSW	9	107,941,202 (GRCm39)	frame shift	probably null
R5295:Rnf123	UTSW	9	107,941,202 (GRCm39)	frame shift	probably null
R5394:Rnf123	UTSW	9	107,947,930 (GRCm39)	missense	probably damaging	1.00
R5717:Rnf123	UTSW	9	107,944,623 (GRCm39)	missense	probably damaging	1.00
R6186:Rnf123	UTSW	9	107,947,157 (GRCm39)	missense	possibly damaging	0.55
R6449:Rnf123	UTSW	9	107,933,252 (GRCm39)	missense	probably benign	0.17
R6502:Rnf123	UTSW	9	107,945,531 (GRCm39)	missense	possibly damaging	0.46
R6944:Rnf123	UTSW	9	107,940,822 (GRCm39)	missense	probably benign	0.02
R7003:Rnf123	UTSW	9	107,940,882 (GRCm39)	critical splice acceptor site	probably null
R7088:Rnf123	UTSW	9	107,935,735 (GRCm39)	missense	probably null	1.00
R7092:Rnf123	UTSW	9	107,945,799 (GRCm39)	missense	probably benign	0.07
R7100:Rnf123	UTSW	9	107,933,838 (GRCm39)	missense	probably damaging	1.00
R7257:Rnf123	UTSW	9	107,946,228 (GRCm39)	missense	probably damaging	1.00
R7453:Rnf123	UTSW	9	107,947,607 (GRCm39)	splice site	probably null
R7468:Rnf123	UTSW	9	107,946,208 (GRCm39)	missense	probably benign	0.00
R7517:Rnf123	UTSW	9	107,947,473 (GRCm39)	nonsense	probably null
R7577:Rnf123	UTSW	9	107,947,818 (GRCm39)	missense	probably damaging	1.00
R8296:Rnf123	UTSW	9	107,940,089 (GRCm39)	missense	probably damaging	1.00
R8322:Rnf123	UTSW	9	107,945,706 (GRCm39)	missense	probably benign	0.26
R8754:Rnf123	UTSW	9	107,948,363 (GRCm39)	missense	probably damaging	1.00
R8783:Rnf123	UTSW	9	107,946,272 (GRCm39)	missense	probably benign
R9052:Rnf123	UTSW	9	107,936,930 (GRCm39)	missense	probably damaging	1.00
R9156:Rnf123	UTSW	9	107,940,227 (GRCm39)	splice site	probably benign
R9170:Rnf123	UTSW	9	107,948,375 (GRCm39)	missense	probably damaging	1.00
R9332:Rnf123	UTSW	9	107,944,704 (GRCm39)	missense	probably benign	0.00
R9385:Rnf123	UTSW	9	107,929,467 (GRCm39)	missense	probably benign	0.02
R9394:Rnf123	UTSW	9	107,942,905 (GRCm39)	missense	probably damaging	1.00
R9432:Rnf123	UTSW	9	107,937,008 (GRCm39)	missense	probably damaging	0.96
R9717:Rnf123	UTSW	9	107,954,963 (GRCm39)	missense	probably benign	0.43
Z1176:Rnf123	UTSW	9	107,940,180 (GRCm39)	missense	probably damaging	1.00
Z1176:Rnf123	UTSW	9	107,935,594 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCAGGTAACACGCTTAGCAC -3'
(R):5'- TAACTCAGTGGCACCTACCC -3'

Sequencing Primer
(F):5'- GTAACACGCTTAGCACCCGAG -3'
(R):5'- TCAGTGGCACCTACCCAGTTG -3'

Posted On

2015-04-17