Incidental Mutation 'R3896:Emb'
ID310557
Institutional Source Beutler Lab
Gene Symbol Emb
Ensembl Gene ENSMUSG00000021728
Gene Nameembigin
SynonymsGp70
MMRRC Submission 040807-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R3896 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location117208536-117274415 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) A to G at 117273062 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Tryptophan at position 331 (*331W)
Ref Sequence ENSEMBL: ENSMUSP00000022242 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022242]
Predicted Effect probably null
Transcript: ENSMUST00000022242
AA Change: *331W
SMART Domains Protein: ENSMUSP00000022242
Gene: ENSMUSG00000021728
AA Change: *331W

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
IG_like 74 161 3.47e1 SMART
IG 167 258 2.13e-7 SMART
transmembrane domain 267 289 N/A INTRINSIC
Meta Mutation Damage Score 0.8523 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane glycoprotein that is a member of the immunoglobulin superfamily. The encoded protein may be involved in cell growth and development by mediating interactions between the cell and extracellular matrix. A pseudogene of this gene is found on chromosome 1. [provided by RefSeq, Jan 2009]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503B20Rik A T 3: 146,651,113 N13K possibly damaging Het
4931428F04Rik T A 8: 105,283,288 H343L probably benign Het
Alas1 G T 9: 106,241,801 probably null Het
Arhgap20 A T 9: 51,816,837 I117F probably damaging Het
Asz1 A G 6: 18,075,767 I269T probably benign Het
Atp8a2 C A 14: 60,026,140 probably null Het
Atp8b2 A T 3: 89,957,319 I163K probably damaging Het
Casd1 T A 6: 4,640,980 F700L probably damaging Het
Ccdc80 A G 16: 45,096,621 D580G probably benign Het
Cog7 C T 7: 121,941,169 probably benign Het
Cyp2c66 T C 19: 39,142,278 V112A possibly damaging Het
D130040H23Rik T A 8: 69,302,958 C356S probably damaging Het
Enpp3 A C 10: 24,777,949 S703R possibly damaging Het
Fam13b T C 18: 34,462,955 probably benign Het
Foxp1 T A 6: 99,075,936 Q97L probably benign Het
Gdf10 A T 14: 33,934,481 N467Y probably damaging Het
Gm29394 C T 15: 58,048,628 probably benign Het
Gsn T C 2: 35,302,638 S522P possibly damaging Het
Hydin T A 8: 110,509,079 F1899I possibly damaging Het
Ints1 C A 5: 139,757,644 E1658* probably null Het
Jakmip2 A T 18: 43,549,686 F691Y probably benign Het
Klhl28 A G 12: 64,957,559 F60S probably damaging Het
Loxhd1 C T 18: 77,382,023 S992L possibly damaging Het
Lrp1b A T 2: 40,922,428 probably null Het
Macf1 A T 4: 123,471,194 I3258N possibly damaging Het
Map4k2 G T 19: 6,341,928 E91* probably null Het
Myo1b A T 1: 51,773,261 V739E probably damaging Het
Naa35 C T 13: 59,607,295 T185I probably damaging Het
Olfr1229 A G 2: 89,283,097 F33S possibly damaging Het
Olfr1418 T C 19: 11,855,587 D122G probably damaging Het
Reg4 A T 3: 98,224,766 probably benign Het
Rnaseh2b A C 14: 62,360,457 probably benign Het
Rnf123 G A 9: 108,069,103 probably benign Het
Scn8a A T 15: 101,035,498 M1528L probably benign Het
Sdr16c5 T A 4: 4,006,609 T228S probably damaging Het
Sgo2a T C 1: 58,013,646 C202R probably damaging Het
Slc25a46 A G 18: 31,583,672 L259P probably damaging Het
Slc4a4 A G 5: 89,197,766 probably benign Het
Sox14 G T 9: 99,875,583 H34Q probably damaging Het
Syna T A 5: 134,558,311 K595* probably null Het
Taf4 A G 2: 179,932,014 V687A probably benign Het
Tmbim7 C T 5: 3,661,916 H54Y probably benign Het
Vmn1r212 T C 13: 22,883,897 M89V probably benign Het
Vmn1r86 T C 7: 13,102,166 Y261C probably benign Het
Xkr4 A G 1: 3,216,191 I592T probably damaging Het
Ywhah A G 5: 33,027,005 Y184C probably damaging Het
Zkscan16 C T 4: 58,946,125 probably benign Het
Other mutations in Emb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01406:Emb APN 13 117268930 missense probably damaging 1.00
IGL01613:Emb APN 13 117272078 missense probably damaging 1.00
IGL01780:Emb APN 13 117249471 unclassified probably benign
IGL02187:Emb APN 13 117268971 splice site probably benign
IGL02350:Emb APN 13 117249471 unclassified probably benign
IGL02357:Emb APN 13 117249471 unclassified probably benign
IGL02728:Emb APN 13 117232765 missense probably benign 0.39
IGL02948:Emb APN 13 117273066 utr 3 prime probably benign
R0098:Emb UTSW 13 117267498 missense probably damaging 1.00
R0098:Emb UTSW 13 117267498 missense probably damaging 1.00
R0540:Emb UTSW 13 117232750 missense possibly damaging 0.81
R0607:Emb UTSW 13 117232750 missense possibly damaging 0.81
R1421:Emb UTSW 13 117272088 missense probably benign 0.00
R1749:Emb UTSW 13 117249706 missense possibly damaging 0.62
R2129:Emb UTSW 13 117267546 missense probably damaging 1.00
R4371:Emb UTSW 13 117268930 missense probably damaging 1.00
R4990:Emb UTSW 13 117264510 missense probably damaging 1.00
R5398:Emb UTSW 13 117267552 missense probably damaging 0.97
R5949:Emb UTSW 13 117267392 missense probably benign 0.13
R6330:Emb UTSW 13 117249130 unclassified probably null
R7221:Emb UTSW 13 117267477 missense probably damaging 1.00
R7479:Emb UTSW 13 117249426 missense possibly damaging 0.51
R7548:Emb UTSW 13 117272054 missense possibly damaging 0.94
R7557:Emb UTSW 13 117249716 missense probably benign 0.21
R7605:Emb UTSW 13 117264510 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTATACATTTTCTCCCTTGGGCTAG -3'
(R):5'- CAGCTGAAACAATTGACCTTGC -3'

Sequencing Primer
(F):5'- TGAATTCATCCACCATAGCAAACTTC -3'
(R):5'- GAAACAATTGACCTTGCTTTAATGG -3'
Posted On2015-04-17