Mutagenetix > Incidental Mutations

Incidental Mutation 'R3896:Atp8a2'

310559

Institutional Source

Beutler Lab

Gene Symbol

Atp8a2

Ensembl Gene

ENSMUSG00000021983

Gene Name

ATPase, aminophospholipid transporter-like, class I, type 8A, member 2

Synonyms

wl, Ib

MMRRC Submission

040807-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.199) question?

Stock #

R3896 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

59638540-60197179 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

C to A at 60026140 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000079238 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000080368] [ENSMUST00000145071]

Predicted Effect

probably null
Transcript: ENSMUST00000080368

SMART Domains

Protein: ENSMUSP00000079238
Gene: ENSMUSG00000021983

Domain	Start	End	E-Value	Type
Pfam:PhoLip_ATPase_N	14	80	2.3e-27	PFAM
Pfam:E1-E2_ATPase	85	348	6.7e-15	PFAM
Pfam:HAD	385	790	3.2e-22	PFAM
Pfam:Cation_ATPase	465	564	3.2e-14	PFAM
Pfam:PhoLip_ATPase_C	807	1059	2.8e-79	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000145071

SMART Domains

Protein: ENSMUSP00000115592
Gene: ENSMUSG00000021983

Domain	Start	End	E-Value	Type
SCOP:d1eula_	21	129	1e-6	SMART

Meta Mutation Damage Score

0.9489

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

100% (48/48)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the P4 ATPase family of proteins, which are thought to be involved in a process called lipid flipping, whereby phospholipids are translocated inwards from the exoplasmic leaflet to the cytosolic leaflet of the cell membrane, which aids in generating and maintaining asymmetry in membrane lipids. This protein is predicted to contain an E1 E2 ATPase, a haloacid dehalogenase-like hydrolase (HAD) domain, and multiple transmembrane domains. Associations between this protein and cell cycle control protein 50A are important for translocation of phosphatidylserine across membranes. Mutations in this gene have been associated with cerebellar ataxia, mental retardation and disequilibrium syndrome (CAMRQ). In addition, a translocation breakpoint within this gene was observed in an individual with neurological dysfunction. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygotes for spontaneous mutations have abnormal gait and tremors, with axonal degeneration in central and peripheral neurons. Symptoms progress to immobility and death by 1-month of age. Heterozygotes show subtle locomotor abnormalities and are hyporesponsive to tail pinching. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930503B20Rik	A	T	3: 146,651,113	N13K	possibly damaging	Het
4931428F04Rik	T	A	8: 105,283,288	H343L	probably benign	Het
Alas1	G	T	9: 106,241,801		probably null	Het
Arhgap20	A	T	9: 51,816,837	I117F	probably damaging	Het
Asz1	A	G	6: 18,075,767	I269T	probably benign	Het
Atp8b2	A	T	3: 89,957,319	I163K	probably damaging	Het
Casd1	T	A	6: 4,640,980	F700L	probably damaging	Het
Ccdc80	A	G	16: 45,096,621	D580G	probably benign	Het
Cog7	C	T	7: 121,941,169		probably benign	Het
Cyp2c66	T	C	19: 39,142,278	V112A	possibly damaging	Het
D130040H23Rik	T	A	8: 69,302,958	C356S	probably damaging	Het
Emb	A	G	13: 117,273,062	*331W	probably null	Het
Enpp3	A	C	10: 24,777,949	S703R	possibly damaging	Het
Fam13b	T	C	18: 34,462,955		probably benign	Het
Foxp1	T	A	6: 99,075,936	Q97L	probably benign	Het
Gdf10	A	T	14: 33,934,481	N467Y	probably damaging	Het
Gm29394	C	T	15: 58,048,628		probably benign	Het
Gsn	T	C	2: 35,302,638	S522P	possibly damaging	Het
Hydin	T	A	8: 110,509,079	F1899I	possibly damaging	Het
Ints1	C	A	5: 139,757,644	E1658*	probably null	Het
Jakmip2	A	T	18: 43,549,686	F691Y	probably benign	Het
Klhl28	A	G	12: 64,957,559	F60S	probably damaging	Het
Loxhd1	C	T	18: 77,382,023	S992L	possibly damaging	Het
Lrp1b	A	T	2: 40,922,428		probably null	Het
Macf1	A	T	4: 123,471,194	I3258N	possibly damaging	Het
Map4k2	G	T	19: 6,341,928	E91*	probably null	Het
Myo1b	A	T	1: 51,773,261	V739E	probably damaging	Het
Naa35	C	T	13: 59,607,295	T185I	probably damaging	Het
Olfr1229	A	G	2: 89,283,097	F33S	possibly damaging	Het
Olfr1418	T	C	19: 11,855,587	D122G	probably damaging	Het
Reg4	A	T	3: 98,224,766		probably benign	Het
Rnaseh2b	A	C	14: 62,360,457		probably benign	Het
Rnf123	G	A	9: 108,069,103		probably benign	Het
Scn8a	A	T	15: 101,035,498	M1528L	probably benign	Het
Sdr16c5	T	A	4: 4,006,609	T228S	probably damaging	Het
Sgo2a	T	C	1: 58,013,646	C202R	probably damaging	Het
Slc25a46	A	G	18: 31,583,672	L259P	probably damaging	Het
Slc4a4	A	G	5: 89,197,766		probably benign	Het
Sox14	G	T	9: 99,875,583	H34Q	probably damaging	Het
Syna	T	A	5: 134,558,311	K595*	probably null	Het
Taf4	A	G	2: 179,932,014	V687A	probably benign	Het
Tmbim7	C	T	5: 3,661,916	H54Y	probably benign	Het
Vmn1r212	T	C	13: 22,883,897	M89V	probably benign	Het
Vmn1r86	T	C	7: 13,102,166	Y261C	probably benign	Het
Xkr4	A	G	1: 3,216,191	I592T	probably damaging	Het
Ywhah	A	G	5: 33,027,005	Y184C	probably damaging	Het
Zkscan16	C	T	4: 58,946,125		probably benign	Het

Other mutations in Atp8a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01289:Atp8a2	APN	14	59691461	missense	probably benign	0.00
IGL01505:Atp8a2	APN	14	60028063	missense	probably benign	0.00
IGL01614:Atp8a2	APN	14	60044988	missense	probably damaging	0.99
IGL01621:Atp8a2	APN	14	60015868	splice site	probably benign
IGL01634:Atp8a2	APN	14	59998062	missense	probably benign	0.01
IGL01672:Atp8a2	APN	14	59691533	missense	probably benign	0.01
IGL01898:Atp8a2	APN	14	60023513	missense	probably damaging	1.00
IGL01945:Atp8a2	APN	14	60026160	missense	probably damaging	1.00
IGL02006:Atp8a2	APN	14	59857048	missense	possibly damaging	0.90
IGL02089:Atp8a2	APN	14	60026920	splice site	probably null
IGL02211:Atp8a2	APN	14	60027976	missense	probably benign	0.00
IGL02283:Atp8a2	APN	14	60016799	missense	possibly damaging	0.86
IGL02337:Atp8a2	APN	14	59998002	missense	probably benign	0.32
IGL02571:Atp8a2	APN	14	60012458	splice site	probably benign
IGL02795:Atp8a2	APN	14	60033742	missense	probably damaging	0.96
IGL02874:Atp8a2	APN	14	59802252	missense	probably damaging	1.00
IGL02999:Atp8a2	APN	14	59925122	nonsense	probably null
IGL03307:Atp8a2	APN	14	60015872	critical splice donor site	probably null
IGL03345:Atp8a2	APN	14	59774011	missense	probably benign
PIT4431001:Atp8a2	UTSW	14	59654626	missense	probably benign
R0334:Atp8a2	UTSW	14	59691512	missense	probably damaging	1.00
R0368:Atp8a2	UTSW	14	59860212	missense	probably damaging	1.00
R0420:Atp8a2	UTSW	14	59773744	missense	probably damaging	1.00
R0684:Atp8a2	UTSW	14	60023144	missense	probably benign	0.00
R0755:Atp8a2	UTSW	14	60009881	missense	possibly damaging	0.96
R0853:Atp8a2	UTSW	14	59860270	missense	probably benign	0.01
R0908:Atp8a2	UTSW	14	59860270	missense	probably benign	0.01
R0991:Atp8a2	UTSW	14	59793929	missense	probably benign	0.33
R1025:Atp8a2	UTSW	14	59860270	missense	probably benign	0.01
R1190:Atp8a2	UTSW	14	59860270	missense	probably benign	0.01
R1387:Atp8a2	UTSW	14	59860270	missense	probably benign	0.01
R1426:Atp8a2	UTSW	14	59860270	missense	probably benign	0.01
R1442:Atp8a2	UTSW	14	59860323	splice site	probably benign
R1472:Atp8a2	UTSW	14	59860270	missense	probably benign	0.01
R1538:Atp8a2	UTSW	14	59860270	missense	probably benign	0.01
R1573:Atp8a2	UTSW	14	59860206	missense	probably benign	0.00
R1620:Atp8a2	UTSW	14	59791183	missense	probably benign
R1661:Atp8a2	UTSW	14	59860186	missense	possibly damaging	0.80
R1673:Atp8a2	UTSW	14	59791240	missense	probably benign	0.00
R1749:Atp8a2	UTSW	14	59860174	nonsense	probably null
R1796:Atp8a2	UTSW	14	60020758	critical splice donor site	probably null
R1815:Atp8a2	UTSW	14	60086624	missense	probably damaging	1.00
R1836:Atp8a2	UTSW	14	60006366	missense	possibly damaging	0.49
R1935:Atp8a2	UTSW	14	59860270	missense	probably benign	0.01
R1936:Atp8a2	UTSW	14	59860270	missense	probably benign	0.01
R1937:Atp8a2	UTSW	14	59860270	missense	probably benign	0.01
R2416:Atp8a2	UTSW	14	59925008	missense	probably damaging	1.00
R2760:Atp8a2	UTSW	14	59860192	missense	probably benign	0.43
R3029:Atp8a2	UTSW	14	59691465	frame shift	probably null
R3621:Atp8a2	UTSW	14	60026138	splice site	probably null
R3768:Atp8a2	UTSW	14	60044336	missense	probably benign	0.19
R3784:Atp8a2	UTSW	14	59773966	missense	probably damaging	1.00
R4009:Atp8a2	UTSW	14	60027985	missense	possibly damaging	0.54
R4591:Atp8a2	UTSW	14	59654629	missense	probably benign	0.03
R4866:Atp8a2	UTSW	14	59691467	missense	probably damaging	1.00
R4879:Atp8a2	UTSW	14	60008469	nonsense	probably null
R5059:Atp8a2	UTSW	14	59691537	missense	probably benign	0.00
R5529:Atp8a2	UTSW	14	59793865	critical splice donor site	probably null
R5788:Atp8a2	UTSW	14	60020793	missense	probably damaging	0.96
R6126:Atp8a2	UTSW	14	60044326	missense	probably benign
R6295:Atp8a2	UTSW	14	60012399	nonsense	probably null
R6393:Atp8a2	UTSW	14	59773755	nonsense	probably null
R6454:Atp8a2	UTSW	14	60008499	splice site	probably null
R6651:Atp8a2	UTSW	14	59774021	missense	probably benign	0.00
R6763:Atp8a2	UTSW	14	60008408	missense	probably benign	0.12
R6767:Atp8a2	UTSW	14	60046722	missense	probably damaging	1.00
R6912:Atp8a2	UTSW	14	60012410	missense	probably benign	0.33
R7032:Atp8a2	UTSW	14	60017840	intron	probably null
R7243:Atp8a2	UTSW	14	59647842	missense	probably benign
R7352:Atp8a2	UTSW	14	59791204	missense	probably benign
R7355:Atp8a2	UTSW	14	60045004	missense	possibly damaging	0.65
R7382:Atp8a2	UTSW	14	59654594	missense	probably benign	0.00
R7451:Atp8a2	UTSW	14	59791181	missense	probably null	0.00
R7483:Atp8a2	UTSW	14	60008375	missense	probably benign	0.00
R7516:Atp8a2	UTSW	14	59857067	missense	probably damaging	1.00
R7831:Atp8a2	UTSW	14	59773753	missense	probably damaging	0.99
R7914:Atp8a2	UTSW	14	59773753	missense	probably damaging	0.99
Z1088:Atp8a2	UTSW	14	60027970	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ACAACGTTCTGCACATTGTTCATTC -3'
(R):5'- GCAGCTCCAGTTTTAGCCAAG -3'

Sequencing Primer
(F):5'- TCTGCACATTGTTCATTCAGATATG -3'
(R):5'- GCTCCAGTTTTAGCCAAGTTAAAAGG -3'

Posted On

2015-04-17