Incidental Mutation 'R3896:Atp8a2'
ID310559
Institutional Source Beutler Lab
Gene Symbol Atp8a2
Ensembl Gene ENSMUSG00000021983
Gene NameATPase, aminophospholipid transporter-like, class I, type 8A, member 2
Synonymswl, Ib
MMRRC Submission 040807-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.199) question?
Stock #R3896 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location59638540-60197179 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to A at 60026140 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000079238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080368] [ENSMUST00000145071]
Predicted Effect probably null
Transcript: ENSMUST00000080368
SMART Domains Protein: ENSMUSP00000079238
Gene: ENSMUSG00000021983

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 14 80 2.3e-27 PFAM
Pfam:E1-E2_ATPase 85 348 6.7e-15 PFAM
Pfam:HAD 385 790 3.2e-22 PFAM
Pfam:Cation_ATPase 465 564 3.2e-14 PFAM
Pfam:PhoLip_ATPase_C 807 1059 2.8e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145071
SMART Domains Protein: ENSMUSP00000115592
Gene: ENSMUSG00000021983

DomainStartEndE-ValueType
SCOP:d1eula_ 21 129 1e-6 SMART
Meta Mutation Damage Score 0.9489 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the P4 ATPase family of proteins, which are thought to be involved in a process called lipid flipping, whereby phospholipids are translocated inwards from the exoplasmic leaflet to the cytosolic leaflet of the cell membrane, which aids in generating and maintaining asymmetry in membrane lipids. This protein is predicted to contain an E1 E2 ATPase, a haloacid dehalogenase-like hydrolase (HAD) domain, and multiple transmembrane domains. Associations between this protein and cell cycle control protein 50A are important for translocation of phosphatidylserine across membranes. Mutations in this gene have been associated with cerebellar ataxia, mental retardation and disequilibrium syndrome (CAMRQ). In addition, a translocation breakpoint within this gene was observed in an individual with neurological dysfunction. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygotes for spontaneous mutations have abnormal gait and tremors, with axonal degeneration in central and peripheral neurons. Symptoms progress to immobility and death by 1-month of age. Heterozygotes show subtle locomotor abnormalities and are hyporesponsive to tail pinching. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503B20Rik A T 3: 146,651,113 N13K possibly damaging Het
4931428F04Rik T A 8: 105,283,288 H343L probably benign Het
Alas1 G T 9: 106,241,801 probably null Het
Arhgap20 A T 9: 51,816,837 I117F probably damaging Het
Asz1 A G 6: 18,075,767 I269T probably benign Het
Atp8b2 A T 3: 89,957,319 I163K probably damaging Het
Casd1 T A 6: 4,640,980 F700L probably damaging Het
Ccdc80 A G 16: 45,096,621 D580G probably benign Het
Cog7 C T 7: 121,941,169 probably benign Het
Cyp2c66 T C 19: 39,142,278 V112A possibly damaging Het
D130040H23Rik T A 8: 69,302,958 C356S probably damaging Het
Emb A G 13: 117,273,062 *331W probably null Het
Enpp3 A C 10: 24,777,949 S703R possibly damaging Het
Fam13b T C 18: 34,462,955 probably benign Het
Foxp1 T A 6: 99,075,936 Q97L probably benign Het
Gdf10 A T 14: 33,934,481 N467Y probably damaging Het
Gm29394 C T 15: 58,048,628 probably benign Het
Gsn T C 2: 35,302,638 S522P possibly damaging Het
Hydin T A 8: 110,509,079 F1899I possibly damaging Het
Ints1 C A 5: 139,757,644 E1658* probably null Het
Jakmip2 A T 18: 43,549,686 F691Y probably benign Het
Klhl28 A G 12: 64,957,559 F60S probably damaging Het
Loxhd1 C T 18: 77,382,023 S992L possibly damaging Het
Lrp1b A T 2: 40,922,428 probably null Het
Macf1 A T 4: 123,471,194 I3258N possibly damaging Het
Map4k2 G T 19: 6,341,928 E91* probably null Het
Myo1b A T 1: 51,773,261 V739E probably damaging Het
Naa35 C T 13: 59,607,295 T185I probably damaging Het
Olfr1229 A G 2: 89,283,097 F33S possibly damaging Het
Olfr1418 T C 19: 11,855,587 D122G probably damaging Het
Reg4 A T 3: 98,224,766 probably benign Het
Rnaseh2b A C 14: 62,360,457 probably benign Het
Rnf123 G A 9: 108,069,103 probably benign Het
Scn8a A T 15: 101,035,498 M1528L probably benign Het
Sdr16c5 T A 4: 4,006,609 T228S probably damaging Het
Sgo2a T C 1: 58,013,646 C202R probably damaging Het
Slc25a46 A G 18: 31,583,672 L259P probably damaging Het
Slc4a4 A G 5: 89,197,766 probably benign Het
Sox14 G T 9: 99,875,583 H34Q probably damaging Het
Syna T A 5: 134,558,311 K595* probably null Het
Taf4 A G 2: 179,932,014 V687A probably benign Het
Tmbim7 C T 5: 3,661,916 H54Y probably benign Het
Vmn1r212 T C 13: 22,883,897 M89V probably benign Het
Vmn1r86 T C 7: 13,102,166 Y261C probably benign Het
Xkr4 A G 1: 3,216,191 I592T probably damaging Het
Ywhah A G 5: 33,027,005 Y184C probably damaging Het
Zkscan16 C T 4: 58,946,125 probably benign Het
Other mutations in Atp8a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01289:Atp8a2 APN 14 59691461 missense probably benign 0.00
IGL01505:Atp8a2 APN 14 60028063 missense probably benign 0.00
IGL01614:Atp8a2 APN 14 60044988 missense probably damaging 0.99
IGL01621:Atp8a2 APN 14 60015868 splice site probably benign
IGL01634:Atp8a2 APN 14 59998062 missense probably benign 0.01
IGL01672:Atp8a2 APN 14 59691533 missense probably benign 0.01
IGL01898:Atp8a2 APN 14 60023513 missense probably damaging 1.00
IGL01945:Atp8a2 APN 14 60026160 missense probably damaging 1.00
IGL02006:Atp8a2 APN 14 59857048 missense possibly damaging 0.90
IGL02089:Atp8a2 APN 14 60026920 splice site probably null
IGL02211:Atp8a2 APN 14 60027976 missense probably benign 0.00
IGL02283:Atp8a2 APN 14 60016799 missense possibly damaging 0.86
IGL02337:Atp8a2 APN 14 59998002 missense probably benign 0.32
IGL02571:Atp8a2 APN 14 60012458 splice site probably benign
IGL02795:Atp8a2 APN 14 60033742 missense probably damaging 0.96
IGL02874:Atp8a2 APN 14 59802252 missense probably damaging 1.00
IGL02999:Atp8a2 APN 14 59925122 nonsense probably null
IGL03307:Atp8a2 APN 14 60015872 critical splice donor site probably null
IGL03345:Atp8a2 APN 14 59774011 missense probably benign
PIT4431001:Atp8a2 UTSW 14 59654626 missense probably benign
R0334:Atp8a2 UTSW 14 59691512 missense probably damaging 1.00
R0368:Atp8a2 UTSW 14 59860212 missense probably damaging 1.00
R0420:Atp8a2 UTSW 14 59773744 missense probably damaging 1.00
R0684:Atp8a2 UTSW 14 60023144 missense probably benign 0.00
R0755:Atp8a2 UTSW 14 60009881 missense possibly damaging 0.96
R0853:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R0908:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R0991:Atp8a2 UTSW 14 59793929 missense probably benign 0.33
R1025:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1190:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1387:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1426:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1442:Atp8a2 UTSW 14 59860323 splice site probably benign
R1472:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1538:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1573:Atp8a2 UTSW 14 59860206 missense probably benign 0.00
R1620:Atp8a2 UTSW 14 59791183 missense probably benign
R1661:Atp8a2 UTSW 14 59860186 missense possibly damaging 0.80
R1673:Atp8a2 UTSW 14 59791240 missense probably benign 0.00
R1749:Atp8a2 UTSW 14 59860174 nonsense probably null
R1796:Atp8a2 UTSW 14 60020758 critical splice donor site probably null
R1815:Atp8a2 UTSW 14 60086624 missense probably damaging 1.00
R1836:Atp8a2 UTSW 14 60006366 missense possibly damaging 0.49
R1935:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1936:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1937:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R2416:Atp8a2 UTSW 14 59925008 missense probably damaging 1.00
R2760:Atp8a2 UTSW 14 59860192 missense probably benign 0.43
R3029:Atp8a2 UTSW 14 59691465 frame shift probably null
R3621:Atp8a2 UTSW 14 60026138 splice site probably null
R3768:Atp8a2 UTSW 14 60044336 missense probably benign 0.19
R3784:Atp8a2 UTSW 14 59773966 missense probably damaging 1.00
R4009:Atp8a2 UTSW 14 60027985 missense possibly damaging 0.54
R4591:Atp8a2 UTSW 14 59654629 missense probably benign 0.03
R4866:Atp8a2 UTSW 14 59691467 missense probably damaging 1.00
R4879:Atp8a2 UTSW 14 60008469 nonsense probably null
R5059:Atp8a2 UTSW 14 59691537 missense probably benign 0.00
R5529:Atp8a2 UTSW 14 59793865 critical splice donor site probably null
R5788:Atp8a2 UTSW 14 60020793 missense probably damaging 0.96
R6126:Atp8a2 UTSW 14 60044326 missense probably benign
R6295:Atp8a2 UTSW 14 60012399 nonsense probably null
R6393:Atp8a2 UTSW 14 59773755 nonsense probably null
R6454:Atp8a2 UTSW 14 60008499 splice site probably null
R6651:Atp8a2 UTSW 14 59774021 missense probably benign 0.00
R6763:Atp8a2 UTSW 14 60008408 missense probably benign 0.12
R6767:Atp8a2 UTSW 14 60046722 missense probably damaging 1.00
R6912:Atp8a2 UTSW 14 60012410 missense probably benign 0.33
R7032:Atp8a2 UTSW 14 60017840 intron probably null
R7243:Atp8a2 UTSW 14 59647842 missense probably benign
R7352:Atp8a2 UTSW 14 59791204 missense probably benign
R7355:Atp8a2 UTSW 14 60045004 missense possibly damaging 0.65
R7382:Atp8a2 UTSW 14 59654594 missense probably benign 0.00
R7451:Atp8a2 UTSW 14 59791181 missense probably null 0.00
R7483:Atp8a2 UTSW 14 60008375 missense probably benign 0.00
R7516:Atp8a2 UTSW 14 59857067 missense probably damaging 1.00
R7831:Atp8a2 UTSW 14 59773753 missense probably damaging 0.99
R7914:Atp8a2 UTSW 14 59773753 missense probably damaging 0.99
Z1088:Atp8a2 UTSW 14 60027970 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACAACGTTCTGCACATTGTTCATTC -3'
(R):5'- GCAGCTCCAGTTTTAGCCAAG -3'

Sequencing Primer
(F):5'- TCTGCACATTGTTCATTCAGATATG -3'
(R):5'- GCTCCAGTTTTAGCCAAGTTAAAAGG -3'
Posted On2015-04-17