Mutagenetix > Incidental Mutation

Incidental Mutation 'R3884:Nedd4'

310593

Institutional Source

Beutler Lab

Gene Symbol

Nedd4

Ensembl Gene

ENSMUSG00000032216

Gene Name

neural precursor cell expressed, developmentally down-regulated 4

Synonyms

Nedd4, Nedd4-1, Nedd4a

MMRRC Submission

040797-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R3884 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

72662346-72749852 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 72725077 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 398 (P398S)

Ref Sequence

ENSEMBL: ENSMUSP00000034740 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034740] [ENSMUST00000184333] [ENSMUST00000184450]

AlphaFold

P46935

PDB Structure

Crystal structure of the Nedd4 C2/Grb10 SH2 complex [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000034740
AA Change: P398S

PolyPhen 2 Score 0.158 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000034740
Gene: ENSMUSG00000032216
AA Change: P398S

Domain	Start	End	E-Value	Type
C2	79	181	5.38e-21	SMART
WW	250	282	2.32e-13	SMART
low complexity region	283	293	N/A	INTRINSIC
WW	406	438	1.31e-12	SMART
WW	461	493	1.26e-14	SMART
HECTc	550	886	2.37e-194	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000184333

SMART Domains

Protein: ENSMUSP00000139190
Gene: ENSMUSG00000032216

Domain	Start	End	E-Value	Type
C2	4	71	3.38e-4	SMART
WW	140	172	2.32e-13	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000184450

SMART Domains

Protein: ENSMUSP00000138983
Gene: ENSMUSG00000032216

Domain	Start	End	E-Value	Type
C2	79	181	5.38e-21	SMART
WW	250	282	2.32e-13	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194508

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.6%
20x: 95.9%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous mutation of this gene results in neonatal lethality and heterozygous mice have decreased body weights. Mice homozygous for a knockout allele exhibit impaired neurite development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy6	G	A	15: 98,597,174	S719F	probably benign	Het
Als2	A	G	1: 59,185,568	V998A	probably damaging	Het
Ankmy1	T	G	1: 92,886,152	E435A	probably damaging	Het
Ankrd52	A	G	10: 128,388,955	E820G	probably damaging	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
Atp6v0d2	T	A	4: 19,910,677	D71V	probably damaging	Het
C3	T	C	17: 57,217,173		probably null	Het
Cnot7	A	T	8: 40,510,130	M1K	probably null	Het
Cntn2	A	G	1: 132,528,939	V123A	probably damaging	Het
Depdc5	G	A	5: 32,944,077	E904K	probably damaging	Het
Dip2c	G	T	13: 9,551,858	L284F	probably damaging	Het
Epb41l3	C	T	17: 69,274,116	R552*	probably null	Het
Gabra4	T	C	5: 71,657,257	D40G	probably benign	Het
Gm9925	T	C	18: 74,065,328		probably benign	Het
Igf2r	T	A	17: 12,709,468	Q996L	probably benign	Het
Klk1b16	T	C	7: 44,139,463	V40A	possibly damaging	Het
Lin9	G	T	1: 180,688,065	G427*	probably null	Het
Lsmem1	GTACATACATACATACATACATACATACA	GTACATACATACATACATACATACA	12: 40,185,261		probably null	Het
Lyg2	C	G	1: 37,910,069	A71P	probably damaging	Het
Mycbp2	A	C	14: 103,295,250	L390V	probably damaging	Het
Myl3	A	G	9: 110,767,959	H129R	probably damaging	Het
Naa16	T	C	14: 79,343,262	K604R	probably damaging	Het
Neurl1a	T	C	19: 47,253,446	V309A	probably benign	Het
Olfr714	A	T	7: 107,073,903	Q25L	possibly damaging	Het
Olfr800	T	C	10: 129,660,538	V244A	probably damaging	Het
Pacs1	T	C	19: 5,155,759	Y301C	probably damaging	Het
Parl	A	T	16: 20,283,012	M90K	probably damaging	Het
Plxnc1	A	T	10: 94,910,687		probably null	Het
Prkd2	C	A	7: 16,853,255	S375R	probably benign	Het
Prss44	T	C	9: 110,814,696	I136T	possibly damaging	Het
Rock1	G	A	18: 10,122,768	T351I	probably damaging	Het
Selenon	T	C	4: 134,539,770	N507S	possibly damaging	Het
Slc38a7	C	T	8: 95,846,181	G141R	probably damaging	Het
Trpm4	C	T	7: 45,321,998		probably null	Het
Ttn	T	A	2: 76,730,361	N27486I	probably damaging	Het
Xylb	T	C	9: 119,380,687	M346T	probably damaging	Het
Zbtb17	T	C	4: 141,464,575	F306L	probably damaging	Het

Other mutations in Nedd4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Nedd4	APN	9	72735089	missense	probably damaging	1.00
IGL00573:Nedd4	APN	9	72686056	splice site	probably null
IGL01973:Nedd4	APN	9	72736934	missense	possibly damaging	0.81
IGL02177:Nedd4	APN	9	72747157	missense	probably damaging	1.00
IGL03082:Nedd4	APN	9	72677394	critical splice donor site	probably null
Evaporation	UTSW	9	72686095	missense	probably damaging	1.00
Reduction	UTSW	9	72731271	missense	possibly damaging	0.49
Snookie	UTSW	9	72725064	missense	probably benign	0.04
Sublimation	UTSW	9	72677379	nonsense	probably null
R0194:Nedd4	UTSW	9	72670053	missense	possibly damaging	0.72
R0714:Nedd4	UTSW	9	72731446	splice site	probably benign
R1331:Nedd4	UTSW	9	72677386	missense	probably damaging	1.00
R1633:Nedd4	UTSW	9	72671257	missense	possibly damaging	0.50
R1764:Nedd4	UTSW	9	72730907	missense	probably damaging	0.99
R2192:Nedd4	UTSW	9	72742718	missense	probably damaging	0.99
R2196:Nedd4	UTSW	9	72725074	missense	possibly damaging	0.77
R2220:Nedd4	UTSW	9	72736707	missense	probably damaging	1.00
R2850:Nedd4	UTSW	9	72725074	missense	possibly damaging	0.77
R2994:Nedd4	UTSW	9	72730903	missense	probably benign	0.04
R3040:Nedd4	UTSW	9	72669961	missense	probably benign
R3697:Nedd4	UTSW	9	72740187	missense	probably damaging	1.00
R4475:Nedd4	UTSW	9	72671239	nonsense	probably null
R4476:Nedd4	UTSW	9	72671239	nonsense	probably null
R4883:Nedd4	UTSW	9	72740233	splice site	probably null
R5066:Nedd4	UTSW	9	72710519	missense	probably damaging	1.00
R5947:Nedd4	UTSW	9	72730850	intron	probably benign
R5974:Nedd4	UTSW	9	72743638	critical splice donor site	probably null
R6247:Nedd4	UTSW	9	72726438	missense	probably damaging	1.00
R6651:Nedd4	UTSW	9	72731271	missense	possibly damaging	0.49
R6661:Nedd4	UTSW	9	72686095	missense	probably damaging	1.00
R7170:Nedd4	UTSW	9	72670099	missense	probably benign	0.00
R7237:Nedd4	UTSW	9	72725064	missense	probably benign	0.04
R7653:Nedd4	UTSW	9	72743628	missense	probably damaging	1.00
R7772:Nedd4	UTSW	9	72677326	missense	possibly damaging	0.77
R7905:Nedd4	UTSW	9	72677379	nonsense	probably null
R8194:Nedd4	UTSW	9	72686107	missense	probably damaging	1.00
R8229:Nedd4	UTSW	9	72731388	missense	probably benign	0.00
R8422:Nedd4	UTSW	9	72742682	missense	probably damaging	0.99
R8487:Nedd4	UTSW	9	72670039	missense	probably damaging	0.98
R8733:Nedd4	UTSW	9	72726484	missense	possibly damaging	0.80
R8956:Nedd4	UTSW	9	72726426	missense	probably benign	0.03
R9261:Nedd4	UTSW	9	72677374	missense	possibly damaging	0.93
R9447:Nedd4	UTSW	9	72670099	missense	probably benign
Z1088:Nedd4	UTSW	9	72670078	missense	probably benign	0.22

Predicted Primers

PCR Primer
(F):5'- CAGTCGTGTCTACAACTACATTGG -3'
(R):5'- GACAGTTCTCTTGAGGCTTGAC -3'

Sequencing Primer
(F):5'- AGAGAAGGCATCCCCCGTTTTAG -3'
(R):5'- GACTTCCAAGGTTGTGCCC -3'

Posted On

2015-04-17