Incidental Mutation 'R3884:Adcy6'
ID310607
Institutional Source Beutler Lab
Gene Symbol Adcy6
Ensembl Gene ENSMUSG00000022994
Gene Nameadenylate cyclase 6
Synonyms
MMRRC Submission 040797-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3884 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location98589973-98610076 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 98597174 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 719 (S719F)
Ref Sequence ENSEMBL: ENSMUSP00000093939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096224] [ENSMUST00000228566] [ENSMUST00000228903]
Predicted Effect probably benign
Transcript: ENSMUST00000096224
AA Change: S719F

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000093939
Gene: ENSMUSG00000022994
AA Change: S719F

DomainStartEndE-ValueType
low complexity region 150 166 N/A INTRINSIC
low complexity region 169 177 N/A INTRINSIC
low complexity region 212 228 N/A INTRINSIC
CYCc 331 532 2.95e-63 SMART
Pfam:DUF1053 580 669 3.5e-18 PFAM
transmembrane domain 701 723 N/A INTRINSIC
transmembrane domain 744 763 N/A INTRINSIC
transmembrane domain 815 834 N/A INTRINSIC
transmembrane domain 839 861 N/A INTRINSIC
Blast:CYCc 885 929 5e-20 BLAST
CYCc 939 1147 4.81e-45 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226236
Predicted Effect probably benign
Transcript: ENSMUST00000228566
AA Change: S717F

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228596
Predicted Effect probably benign
Transcript: ENSMUST00000228903
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the adenylyl cyclase family of proteins, which are required for the synthesis of cyclic AMP. All members of this family have an intracellular N-terminus, a tandem repeat of six transmembrane domains separated by a cytoplasmic loop, and a C-terminal cytoplasmic domain. The two cytoplasmic regions bind ATP and form the catalytic core of the protein. Adenylyl cyclases are important effectors of transmembrane signaling pathways and are regulated by the activity of G protein coupled receptor signaling. This protein belongs to a small subclass of adenylyl cyclase proteins that are functionally related and are inhibited by protein kinase A, calcium ions and nitric oxide. A mutation in this gene is associated with arthrogryposis multiplex congenita. [provided by RefSeq, May 2015]
PHENOTYPE: Mice homozygous for disruption of this gene show a reduction in calcium uptake and transport in cardiomyocytes as well as mild functional abnormalities in the left ventricle. Mice homozygous for a conditional allele activated in collecting ducts exhibit decreased urine osmilality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Als2 A G 1: 59,185,568 V998A probably damaging Het
Ankmy1 T G 1: 92,886,152 E435A probably damaging Het
Ankrd52 A G 10: 128,388,955 E820G probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp6v0d2 T A 4: 19,910,677 D71V probably damaging Het
C3 T C 17: 57,217,173 probably null Het
Cnot7 A T 8: 40,510,130 M1K probably null Het
Cntn2 A G 1: 132,528,939 V123A probably damaging Het
Depdc5 G A 5: 32,944,077 E904K probably damaging Het
Dip2c G T 13: 9,551,858 L284F probably damaging Het
Epb41l3 C T 17: 69,274,116 R552* probably null Het
Gabra4 T C 5: 71,657,257 D40G probably benign Het
Gm9925 T C 18: 74,065,328 probably benign Het
Igf2r T A 17: 12,709,468 Q996L probably benign Het
Klk1b16 T C 7: 44,139,463 V40A possibly damaging Het
Lin9 G T 1: 180,688,065 G427* probably null Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACA 12: 40,185,261 probably null Het
Lyg2 C G 1: 37,910,069 A71P probably damaging Het
Mycbp2 A C 14: 103,295,250 L390V probably damaging Het
Myl3 A G 9: 110,767,959 H129R probably damaging Het
Naa16 T C 14: 79,343,262 K604R probably damaging Het
Nedd4 C T 9: 72,725,077 P398S probably benign Het
Neurl1a T C 19: 47,253,446 V309A probably benign Het
Olfr714 A T 7: 107,073,903 Q25L possibly damaging Het
Olfr800 T C 10: 129,660,538 V244A probably damaging Het
Pacs1 T C 19: 5,155,759 Y301C probably damaging Het
Parl A T 16: 20,283,012 M90K probably damaging Het
Plxnc1 A T 10: 94,910,687 probably null Het
Prkd2 C A 7: 16,853,255 S375R probably benign Het
Prss44 T C 9: 110,814,696 I136T possibly damaging Het
Rock1 G A 18: 10,122,768 T351I probably damaging Het
Selenon T C 4: 134,539,770 N507S possibly damaging Het
Slc38a7 C T 8: 95,846,181 G141R probably damaging Het
Trpm4 C T 7: 45,321,998 probably null Het
Ttn T A 2: 76,730,361 N27486I probably damaging Het
Xylb T C 9: 119,380,687 M346T probably damaging Het
Zbtb17 T C 4: 141,464,575 F306L probably damaging Het
Other mutations in Adcy6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01114:Adcy6 APN 15 98598976 missense probably damaging 1.00
IGL01132:Adcy6 APN 15 98597851 missense probably benign 0.14
IGL01642:Adcy6 APN 15 98594509 missense possibly damaging 0.88
IGL01647:Adcy6 APN 15 98600275 missense probably damaging 1.00
IGL01788:Adcy6 APN 15 98596519 nonsense probably null
IGL02122:Adcy6 APN 15 98598882 missense possibly damaging 0.66
IGL02210:Adcy6 APN 15 98594971 missense possibly damaging 0.63
IGL02249:Adcy6 APN 15 98599914 missense probably damaging 1.00
IGL02404:Adcy6 APN 15 98596938 missense probably benign
IGL02691:Adcy6 APN 15 98604304 missense probably damaging 1.00
PIT4515001:Adcy6 UTSW 15 98595146 missense probably benign 0.04
R0178:Adcy6 UTSW 15 98604215 missense probably benign 0.00
R0497:Adcy6 UTSW 15 98597725 critical splice donor site probably null
R0739:Adcy6 UTSW 15 98598379 missense probably benign 0.00
R1454:Adcy6 UTSW 15 98604728 missense probably damaging 1.00
R1473:Adcy6 UTSW 15 98592743 missense probably damaging 0.99
R1536:Adcy6 UTSW 15 98600007 missense probably damaging 1.00
R1927:Adcy6 UTSW 15 98598498 splice site probably null
R2178:Adcy6 UTSW 15 98594355 missense probably damaging 1.00
R2294:Adcy6 UTSW 15 98597441 missense possibly damaging 0.48
R2356:Adcy6 UTSW 15 98597016 splice site probably null
R2898:Adcy6 UTSW 15 98593488 missense probably damaging 1.00
R3001:Adcy6 UTSW 15 98596660 missense probably benign 0.01
R3002:Adcy6 UTSW 15 98596660 missense probably benign 0.01
R3794:Adcy6 UTSW 15 98598943 missense probably damaging 1.00
R4348:Adcy6 UTSW 15 98604160 missense probably benign 0.44
R4351:Adcy6 UTSW 15 98604160 missense probably benign 0.44
R4542:Adcy6 UTSW 15 98598988 missense possibly damaging 0.70
R4548:Adcy6 UTSW 15 98598659 missense probably damaging 1.00
R5693:Adcy6 UTSW 15 98603989 missense probably damaging 1.00
R5707:Adcy6 UTSW 15 98598741 missense probably damaging 1.00
R5994:Adcy6 UTSW 15 98593664 missense probably damaging 1.00
R5998:Adcy6 UTSW 15 98594354 nonsense probably null
R6142:Adcy6 UTSW 15 98598422 missense probably benign
R6242:Adcy6 UTSW 15 98604015 nonsense probably null
R6305:Adcy6 UTSW 15 98598645 missense probably benign 0.13
R6751:Adcy6 UTSW 15 98596205 missense probably benign
R7130:Adcy6 UTSW 15 98597229 missense probably benign
R7335:Adcy6 UTSW 15 98603876 missense probably benign 0.29
R7643:Adcy6 UTSW 15 98593568 missense probably benign
R7658:Adcy6 UTSW 15 98596067 missense probably benign 0.00
R7748:Adcy6 UTSW 15 98604556 missense probably benign 0.01
R7761:Adcy6 UTSW 15 98600014 missense probably damaging 1.00
R7774:Adcy6 UTSW 15 98596533 missense probably benign
X0020:Adcy6 UTSW 15 98598735 missense probably damaging 0.99
X0021:Adcy6 UTSW 15 98603942 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- CGGACAATATTGCGGGACAG -3'
(R):5'- GTTAATGCCCCTAACACCCATG -3'

Sequencing Primer
(F):5'- CAATATTGCGGGACAGGCGTTG -3'
(R):5'- ATGCAAACTGCTGGCCTCAG -3'
Posted On2015-04-17