Incidental Mutation 'R3884:Igf2r'
ID310609
Institutional Source Beutler Lab
Gene Symbol Igf2r
Ensembl Gene ENSMUSG00000023830
Gene Nameinsulin-like growth factor 2 receptor
SynonymsM6P/IGF2R, IGF-II/CI-MPR, Mpr300, CI-MPR, CD222, mannose-6-phosphate receptor, cation independent
MMRRC Submission 040797-MU
Accession Numbers

Genbank: NM_010515.2; Ensembl: ENSMUST00000024599, ENSMUST00000162982, ENSMUST00000159127

Is this an essential gene? Probably essential (E-score: 0.930) question?
Stock #R3884 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location12682406-12769664 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 12709468 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 996 (Q996L)
Ref Sequence ENSEMBL: ENSMUSP00000024599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024599]
Predicted Effect probably benign
Transcript: ENSMUST00000024599
AA Change: Q996L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000024599
Gene: ENSMUSG00000023830
AA Change: Q996L

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
low complexity region 94 104 N/A INTRINSIC
Pfam:CIMR 118 266 5.1e-21 PFAM
Pfam:CIMR 272 416 8.8e-22 PFAM
Pfam:CIMR 418 567 3.4e-53 PFAM
Pfam:CIMR 569 709 6.5e-47 PFAM
Pfam:CIMR 713 869 6.5e-34 PFAM
Pfam:CIMR 876 1020 1.9e-10 PFAM
Pfam:CIMR 1024 1171 1e-60 PFAM
Pfam:CIMR 1172 1313 1.2e-17 PFAM
Pfam:CIMR 1315 1455 2.1e-58 PFAM
Pfam:CIMR 1458 1592 1.8e-22 PFAM
Pfam:CIMR 1596 1743 9.1e-23 PFAM
Pfam:CIMR 1748 1887 2.5e-22 PFAM
FN2 1889 1935 9.51e-26 SMART
Pfam:CIMR 1939 2076 2.1e-22 PFAM
Pfam:CIMR 2230 2294 4.9e-9 PFAM
transmembrane domain 2295 2317 N/A INTRINSIC
low complexity region 2336 2363 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for both insulin-like growth factor 2 and mannose 6-phosphate. The binding sites for each ligand are located on different segments of the protein. This receptor has various functions, including in the intracellular trafficking of lysosomal enzymes, the activation of transforming growth factor beta, and the degradation of insulin-like growth factor 2. Mutation or loss of heterozygosity of this gene has been association with risk of hepatocellular carcinoma. The orthologous mouse gene is imprinted and shows exclusive expression from the maternal allele; however, imprinting of the human gene may be polymorphic, as only a minority of individuals showed biased expression from the maternal allele (PMID:8267611). [provided by RefSeq, Nov 2015]
PHENOTYPE: Mutants inheriting maternally a targeted disruption of this gene exhibit elevated serum and tissue IGF-II levels, overgrowth, organomegaly, kinky tail, polydactyly, heart defects, edema, dyspnea, imperforate vagina, reduced fertility and perinatal death.Survival is influenced by genetic background. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted, knock-out(4) Targeted, other(3) Gene trapped(6)

Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy6 G A 15: 98,597,174 S719F probably benign Het
Als2 A G 1: 59,185,568 V998A probably damaging Het
Ankmy1 T G 1: 92,886,152 E435A probably damaging Het
Ankrd52 A G 10: 128,388,955 E820G probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp6v0d2 T A 4: 19,910,677 D71V probably damaging Het
C3 T C 17: 57,217,173 probably null Het
Cnot7 A T 8: 40,510,130 M1K probably null Het
Cntn2 A G 1: 132,528,939 V123A probably damaging Het
Depdc5 G A 5: 32,944,077 E904K probably damaging Het
Dip2c G T 13: 9,551,858 L284F probably damaging Het
Epb41l3 C T 17: 69,274,116 R552* probably null Het
Gabra4 T C 5: 71,657,257 D40G probably benign Het
Gm9925 T C 18: 74,065,328 probably benign Het
Klk1b16 T C 7: 44,139,463 V40A possibly damaging Het
Lin9 G T 1: 180,688,065 G427* probably null Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACA 12: 40,185,261 probably null Het
Lyg2 C G 1: 37,910,069 A71P probably damaging Het
Mycbp2 A C 14: 103,295,250 L390V probably damaging Het
Myl3 A G 9: 110,767,959 H129R probably damaging Het
Naa16 T C 14: 79,343,262 K604R probably damaging Het
Nedd4 C T 9: 72,725,077 P398S probably benign Het
Neurl1a T C 19: 47,253,446 V309A probably benign Het
Olfr714 A T 7: 107,073,903 Q25L possibly damaging Het
Olfr800 T C 10: 129,660,538 V244A probably damaging Het
Pacs1 T C 19: 5,155,759 Y301C probably damaging Het
Parl A T 16: 20,283,012 M90K probably damaging Het
Plxnc1 A T 10: 94,910,687 probably null Het
Prkd2 C A 7: 16,853,255 S375R probably benign Het
Prss44 T C 9: 110,814,696 I136T possibly damaging Het
Rock1 G A 18: 10,122,768 T351I probably damaging Het
Selenon T C 4: 134,539,770 N507S possibly damaging Het
Slc38a7 C T 8: 95,846,181 G141R probably damaging Het
Trpm4 C T 7: 45,321,998 probably null Het
Ttn T A 2: 76,730,361 N27486I probably damaging Het
Xylb T C 9: 119,380,687 M346T probably damaging Het
Zbtb17 T C 4: 141,464,575 F306L probably damaging Het
Other mutations in Igf2r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Igf2r APN 17 12713990 missense probably benign 0.01
IGL00534:Igf2r APN 17 12739328 missense probably damaging 0.97
IGL00902:Igf2r APN 17 12700358 missense probably damaging 0.99
IGL00903:Igf2r APN 17 12683867 missense possibly damaging 0.70
IGL01160:Igf2r APN 17 12704775 missense possibly damaging 0.73
IGL01380:Igf2r APN 17 12695374 missense probably benign 0.01
IGL01392:Igf2r APN 17 12704349 missense probably benign
IGL01557:Igf2r APN 17 12704635 missense possibly damaging 0.82
IGL01568:Igf2r APN 17 12683985 missense possibly damaging 0.93
IGL01611:Igf2r APN 17 12725415 nonsense probably null
IGL01720:Igf2r APN 17 12701313 missense probably damaging 0.99
IGL01756:Igf2r APN 17 12683822 missense probably benign
IGL01839:Igf2r APN 17 12705022 missense probably damaging 1.00
IGL01904:Igf2r APN 17 12714911 missense probably damaging 0.99
IGL01965:Igf2r APN 17 12704338 missense probably benign 0.12
IGL02083:Igf2r APN 17 12693192 nonsense probably null
IGL02095:Igf2r APN 17 12702005 missense probably damaging 0.99
IGL02183:Igf2r APN 17 12698516 unclassified probably benign
IGL02576:Igf2r APN 17 12748763 missense possibly damaging 0.90
IGL02649:Igf2r APN 17 12712087 missense possibly damaging 0.93
IGL02807:Igf2r APN 17 12719883 missense probably damaging 0.98
IGL02833:Igf2r APN 17 12692723 missense probably damaging 0.97
IGL02885:Igf2r APN 17 12694120 missense possibly damaging 0.94
IGL02990:Igf2r APN 17 12710746 splice site probably benign
IGL03080:Igf2r APN 17 12726676 missense probably benign 0.06
IGL03176:Igf2r APN 17 12716672 missense probably damaging 1.00
NA:Igf2r UTSW 17 12691962 missense probably benign
R0165:Igf2r UTSW 17 12698527 missense probably benign 0.07
R0412:Igf2r UTSW 17 12683948 missense probably damaging 0.98
R0523:Igf2r UTSW 17 12692064 missense probably benign 0.27
R0631:Igf2r UTSW 17 12717274 splice site probably null
R0722:Igf2r UTSW 17 12715495 critical splice acceptor site probably null
R0894:Igf2r UTSW 17 12692101 missense probably benign 0.02
R1265:Igf2r UTSW 17 12694124 missense probably damaging 0.98
R1466:Igf2r UTSW 17 12717269 splice site probably benign
R1485:Igf2r UTSW 17 12691285 missense probably damaging 1.00
R1633:Igf2r UTSW 17 12726309 missense probably benign
R1693:Igf2r UTSW 17 12704316 missense probably damaging 0.97
R1751:Igf2r UTSW 17 12697441 missense possibly damaging 0.94
R1843:Igf2r UTSW 17 12704270 critical splice donor site probably null
R1981:Igf2r UTSW 17 12733903 nonsense probably null
R1994:Igf2r UTSW 17 12692738 missense probably benign
R2060:Igf2r UTSW 17 12701319 missense possibly damaging 0.92
R2108:Igf2r UTSW 17 12698251 missense probably benign 0.02
R2132:Igf2r UTSW 17 12722208 missense probably benign 0.12
R2314:Igf2r UTSW 17 12715943 missense probably benign 0.28
R2349:Igf2r UTSW 17 12722311 intron probably null
R2696:Igf2r UTSW 17 12695344 missense possibly damaging 0.96
R2864:Igf2r UTSW 17 12686724 missense probably damaging 0.99
R2865:Igf2r UTSW 17 12686724 missense probably damaging 0.99
R3930:Igf2r UTSW 17 12705829 missense probably benign 0.01
R4021:Igf2r UTSW 17 12748751 missense probably damaging 0.97
R4125:Igf2r UTSW 17 12702254 missense possibly damaging 0.93
R4342:Igf2r UTSW 17 12709511 missense possibly damaging 0.95
R4343:Igf2r UTSW 17 12709511 missense possibly damaging 0.95
R4345:Igf2r UTSW 17 12709511 missense possibly damaging 0.95
R4760:Igf2r UTSW 17 12703465 missense possibly damaging 0.92
R4796:Igf2r UTSW 17 12684126 missense possibly damaging 0.70
R4816:Igf2r UTSW 17 12684097 missense probably damaging 0.96
R4826:Igf2r UTSW 17 12701353 missense probably damaging 0.98
R4933:Igf2r UTSW 17 12691877 splice site probably null
R4980:Igf2r UTSW 17 12703360 critical splice donor site probably null
R5389:Igf2r UTSW 17 12725416 missense probably damaging 1.00
R5473:Igf2r UTSW 17 12695314 missense probably benign 0.20
R5494:Igf2r UTSW 17 12693145 missense possibly damaging 0.74
R5619:Igf2r UTSW 17 12739334 missense probably damaging 1.00
R5738:Igf2r UTSW 17 12717367 missense probably benign 0.23
R5761:Igf2r UTSW 17 12698352 splice site probably null
R5794:Igf2r UTSW 17 12709445 missense probably benign 0.37
R6210:Igf2r UTSW 17 12714951 missense probably damaging 0.98
R6319:Igf2r UTSW 17 12714113 missense probably damaging 1.00
R6388:Igf2r UTSW 17 12683900 missense probably benign
R6396:Igf2r UTSW 17 12714090 missense probably benign 0.00
R6584:Igf2r UTSW 17 12701250 missense probably damaging 0.99
R6590:Igf2r UTSW 17 12691937 nonsense probably null
R6591:Igf2r UTSW 17 12689008 missense probably damaging 1.00
R6599:Igf2r UTSW 17 12698618 missense possibly damaging 0.85
R6690:Igf2r UTSW 17 12691937 nonsense probably null
R6691:Igf2r UTSW 17 12689008 missense probably damaging 1.00
R6752:Igf2r UTSW 17 12714944 missense probably damaging 1.00
R6816:Igf2r UTSW 17 12714082 missense probably damaging 0.99
R6841:Igf2r UTSW 17 12703376 missense probably damaging 0.97
R6877:Igf2r UTSW 17 12697341 missense probably damaging 0.97
R6950:Igf2r UTSW 17 12718718 missense probably benign
R7030:Igf2r UTSW 17 12733866 missense probably damaging 1.00
R7038:Igf2r UTSW 17 12698325 missense probably benign 0.23
R7055:Igf2r UTSW 17 12704323 missense probably damaging 0.99
R7074:Igf2r UTSW 17 12714116 missense possibly damaging 0.57
R7348:Igf2r UTSW 17 12703484 missense probably damaging 0.99
R7413:Igf2r UTSW 17 12698228 nonsense probably null
R7463:Igf2r UTSW 17 12710645 missense probably benign 0.16
X0028:Igf2r UTSW 17 12704913 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACCCACCTCTGAAGAGCTAG -3'
(R):5'- CAGATACTTAGCCCATTGTTGC -3'

Sequencing Primer
(F):5'- CCTCTGAAGAGCTAGAGGTGC -3'
(R):5'- GTTTGGCTTCCAGTTCAA -3'
Posted On2015-04-17