Incidental Mutation 'R0383:Supt20'
ID31061
Institutional Source Beutler Lab
Gene Symbol Supt20
Ensembl Gene ENSMUSG00000027751
Gene Namesuppressor of Ty 20
SynonymsFam48a, p38IP, D3Ertd300e, p38 interacting protein
MMRRC Submission 038589-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.934) question?
Stock #R0383 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location54692807-54728766 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 54703149 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 124 (L124*)
Ref Sequence ENSEMBL: ENSMUSP00000143059 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029315] [ENSMUST00000170552] [ENSMUST00000197502] [ENSMUST00000197502] [ENSMUST00000199652] [ENSMUST00000199652] [ENSMUST00000199655] [ENSMUST00000199655] [ENSMUST00000199674] [ENSMUST00000200439] [ENSMUST00000200441]
Predicted Effect probably benign
Transcript: ENSMUST00000029315
SMART Domains Protein: ENSMUSP00000029315
Gene: ENSMUSG00000027751

DomainStartEndE-ValueType
low complexity region 65 78 N/A INTRINSIC
low complexity region 107 159 N/A INTRINSIC
coiled coil region 201 230 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000170552
AA Change: L125*
SMART Domains Protein: ENSMUSP00000131454
Gene: ENSMUSG00000027751
AA Change: L125*

DomainStartEndE-ValueType
Pfam:Spt20 63 229 6.8e-47 PFAM
low complexity region 425 441 N/A INTRINSIC
low complexity region 468 477 N/A INTRINSIC
low complexity region 488 502 N/A INTRINSIC
low complexity region 515 526 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000197502
AA Change: L124*
SMART Domains Protein: ENSMUSP00000143750
Gene: ENSMUSG00000027751
AA Change: L124*

DomainStartEndE-ValueType
low complexity region 45 56 N/A INTRINSIC
Pfam:Spt20 62 227 1.9e-43 PFAM
low complexity region 424 440 N/A INTRINSIC
low complexity region 467 476 N/A INTRINSIC
low complexity region 487 501 N/A INTRINSIC
low complexity region 512 532 N/A INTRINSIC
low complexity region 574 587 N/A INTRINSIC
low complexity region 632 680 N/A INTRINSIC
coiled coil region 722 751 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000197502
AA Change: L124*
SMART Domains Protein: ENSMUSP00000143750
Gene: ENSMUSG00000027751
AA Change: L124*

DomainStartEndE-ValueType
low complexity region 45 56 N/A INTRINSIC
Pfam:Spt20 62 227 1.9e-43 PFAM
low complexity region 424 440 N/A INTRINSIC
low complexity region 467 476 N/A INTRINSIC
low complexity region 487 501 N/A INTRINSIC
low complexity region 512 532 N/A INTRINSIC
low complexity region 574 587 N/A INTRINSIC
low complexity region 632 680 N/A INTRINSIC
coiled coil region 722 751 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000199652
AA Change: L124*
SMART Domains Protein: ENSMUSP00000142648
Gene: ENSMUSG00000027751
AA Change: L124*

DomainStartEndE-ValueType
low complexity region 45 56 N/A INTRINSIC
Pfam:Spt20 59 181 1.2e-25 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000199652
AA Change: L124*
SMART Domains Protein: ENSMUSP00000142648
Gene: ENSMUSG00000027751
AA Change: L124*

DomainStartEndE-ValueType
low complexity region 45 56 N/A INTRINSIC
Pfam:Spt20 59 181 1.2e-25 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000199655
AA Change: L124*
SMART Domains Protein: ENSMUSP00000143520
Gene: ENSMUSG00000027751
AA Change: L124*

DomainStartEndE-ValueType
low complexity region 45 56 N/A INTRINSIC
Pfam:Spt20 62 140 5.3e-17 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000199655
AA Change: L124*
SMART Domains Protein: ENSMUSP00000143520
Gene: ENSMUSG00000027751
AA Change: L124*

DomainStartEndE-ValueType
low complexity region 45 56 N/A INTRINSIC
Pfam:Spt20 62 140 5.3e-17 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000199674
AA Change: L124*
SMART Domains Protein: ENSMUSP00000142948
Gene: ENSMUSG00000027751
AA Change: L124*

DomainStartEndE-ValueType
low complexity region 45 56 N/A INTRINSIC
Pfam:Spt20 59 227 3.3e-39 PFAM
low complexity region 424 442 N/A INTRINSIC
low complexity region 466 475 N/A INTRINSIC
low complexity region 486 500 N/A INTRINSIC
low complexity region 513 524 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000200439
AA Change: L124*
SMART Domains Protein: ENSMUSP00000143059
Gene: ENSMUSG00000027751
AA Change: L124*

DomainStartEndE-ValueType
low complexity region 45 56 N/A INTRINSIC
Pfam:Spt20 59 227 2.7e-42 PFAM
low complexity region 424 440 N/A INTRINSIC
low complexity region 467 476 N/A INTRINSIC
low complexity region 487 501 N/A INTRINSIC
low complexity region 514 525 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200441
SMART Domains Protein: ENSMUSP00000143231
Gene: ENSMUSG00000027751

DomainStartEndE-ValueType
low complexity region 65 78 N/A INTRINSIC
low complexity region 123 171 N/A INTRINSIC
coiled coil region 213 242 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200450
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 88.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: The incompletely penetrant homozygous phenotype of a splice-site mutation may include retinal epithelium expansion over the dorsal half of the eye, exencephaly, spina bifida, gastrulation defects and/or aberrant somite and mesoderm development. A few mutants survive postnatally and appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A G 7: 131,239,539 M537V probably benign Het
5730455P16Rik G T 11: 80,363,941 Y351* probably null Het
A530099J19Rik A G 13: 19,729,147 noncoding transcript Het
Aadac G T 3: 60,035,947 R91L possibly damaging Het
Adgrg1 T A 8: 95,011,742 F621Y probably damaging Het
Ankmy1 G T 1: 92,885,053 D511E probably benign Het
Anks4b A T 7: 120,182,874 D376V probably damaging Het
Aox1 G T 1: 58,061,241 C399F probably benign Het
Arfgef1 C T 1: 10,198,842 probably null Het
Arhgef4 G A 1: 34,810,533 V546M probably damaging Het
Cab39 T A 1: 85,837,299 V98E probably damaging Het
Cacna1b T C 2: 24,761,844 N108D probably damaging Het
Car15 C A 16: 17,836,753 E134* probably null Het
Ccdc80 T G 16: 45,095,369 Y163D probably damaging Het
Col22a1 C T 15: 71,869,004 G513D unknown Het
Col8a1 T C 16: 57,632,442 D66G probably damaging Het
Crot C A 5: 8,968,734 S544I probably damaging Het
Cubn G T 2: 13,430,959 P1062Q probably damaging Het
Dcc A T 18: 71,420,263 V774E probably damaging Het
Dlgap5 T A 14: 47,410,361 M240L probably benign Het
Dlx4 A G 11: 95,145,435 V16A probably benign Het
Dnah17 G T 11: 118,067,547 H2703Q probably benign Het
Duox2 A G 2: 122,291,810 probably null Het
Fn1 C T 1: 71,597,685 V168I probably damaging Het
Fpr-rs4 A T 17: 18,022,097 D122V probably damaging Het
Gas2l2 A T 11: 83,423,097 I463N probably benign Het
Ggta1 G T 2: 35,402,404 P297Q probably damaging Het
Gpatch3 C A 4: 133,578,146 R231S probably damaging Het
Gpc1 T C 1: 92,854,983 Y151H probably damaging Het
Gtf2e2 T C 8: 33,755,945 W119R probably damaging Het
H2-M10.2 T C 17: 36,284,361 I304V probably benign Het
Helq T C 5: 100,779,165 K685R probably benign Het
Hps5 C T 7: 46,769,288 probably null Het
Iars T C 13: 49,732,342 C1186R probably damaging Het
Ift43 T C 12: 86,162,021 V158A possibly damaging Het
Iqca A T 1: 90,142,707 I141N probably damaging Het
Kat6b A G 14: 21,669,081 N1276S probably benign Het
Kif19a A T 11: 114,765,514 M1L possibly damaging Het
Kif1b T G 4: 149,202,512 H1241P probably damaging Het
Kif26a T C 12: 112,178,076 V1588A possibly damaging Het
Klb T A 5: 65,372,499 probably null Het
Krtap26-1 A T 16: 88,647,243 Y163* probably null Het
Lefty1 G T 1: 180,937,634 E256* probably null Het
Lox T C 18: 52,529,199 N44S possibly damaging Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Mctp1 A G 13: 76,801,544 Y565C probably damaging Het
Megf6 C T 4: 154,265,326 A961V probably benign Het
Mindy4 A G 6: 55,276,634 K496R probably benign Het
Nalcn A T 14: 123,507,559 H352Q probably benign Het
Ncoa5 T C 2: 165,009,390 I188V possibly damaging Het
Notum G T 11: 120,654,456 H426N probably benign Het
Olfr569 T A 7: 102,887,251 I301F possibly damaging Het
Orm2 A T 4: 63,363,996 D137V probably damaging Het
Pabpc2 G A 18: 39,775,395 G571D probably damaging Het
Pabpc4 A G 4: 123,297,942 N599S probably damaging Het
Pak1ip1 T C 13: 41,012,604 V335A probably benign Het
Pcdhb11 A C 18: 37,423,393 D592A probably damaging Het
Pmch C A 10: 88,091,258 T41K possibly damaging Het
Polb G T 8: 22,639,995 S187* probably null Het
Pter G T 2: 13,000,942 G309* probably null Het
Ptprg T C 14: 12,219,024 V406A possibly damaging Het
Ranbp3l A T 15: 9,063,104 E467V possibly damaging Het
Rif1 T A 2: 52,085,141 M354K probably damaging Het
Ripk4 C T 16: 97,748,112 C248Y probably damaging Het
Slc6a15 T C 10: 103,418,053 W617R probably damaging Het
Smyd5 C T 6: 85,440,173 Q178* probably null Het
St18 T A 1: 6,803,024 F328I probably damaging Het
Tarbp1 T A 8: 126,447,484 H861L probably benign Het
Tars A G 15: 11,390,325 M356T probably benign Het
Tbc1d10a A G 11: 4,212,819 T221A probably damaging Het
Tead3 A G 17: 28,334,698 probably null Het
Tprg A G 16: 25,422,235 T254A probably damaging Het
Trank1 C A 9: 111,391,477 N2427K probably benign Het
Ttc30b A G 2: 75,938,242 Y56H probably damaging Het
Tufm T C 7: 126,489,864 S380P probably damaging Het
Tyrobp C T 7: 30,414,617 R68C probably damaging Het
Ubl4b T C 3: 107,554,827 E39G possibly damaging Het
Uggt2 A T 14: 119,049,451 F661I probably damaging Het
Upf3b A G X: 37,104,467 I144T probably benign Het
Usp54 A T 14: 20,561,252 D1165E probably benign Het
Vmn2r81 C T 10: 79,293,447 T724I possibly damaging Het
Vsig1 A G X: 140,936,313 I247M possibly damaging Het
Zfp110 C A 7: 12,849,260 L612I probably benign Het
Zfp318 C A 17: 46,413,296 T2075K probably damaging Het
Zfp37 A G 4: 62,191,885 M1T probably null Het
Zfp605 T A 5: 110,128,854 C613S probably damaging Het
Zfp729a G A 13: 67,621,673 P146S possibly damaging Het
Zfp85 T C 13: 67,748,672 N427S probably benign Het
Other mutations in Supt20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Supt20 APN 3 54715169 missense probably damaging 0.98
IGL01781:Supt20 APN 3 54695205 start codon destroyed probably null 0.47
IGL02510:Supt20 APN 3 54715524 intron probably benign
IGL02656:Supt20 APN 3 54708395 missense probably damaging 1.00
IGL02958:Supt20 APN 3 54713723 intron probably benign
IGL03036:Supt20 APN 3 54709302 nonsense probably null
IGL03128:Supt20 APN 3 54708287 missense probably benign 0.05
IGL03164:Supt20 APN 3 54713188 missense probably benign 0.01
FR4304:Supt20 UTSW 3 54727647 small insertion probably benign
FR4304:Supt20 UTSW 3 54727662 small insertion probably benign
FR4304:Supt20 UTSW 3 54727664 nonsense probably null
FR4449:Supt20 UTSW 3 54727649 small insertion probably benign
FR4548:Supt20 UTSW 3 54727657 small insertion probably benign
FR4548:Supt20 UTSW 3 54727664 small insertion probably benign
FR4548:Supt20 UTSW 3 54727673 small insertion probably benign
FR4589:Supt20 UTSW 3 54727651 small insertion probably benign
FR4589:Supt20 UTSW 3 54727655 small insertion probably benign
FR4589:Supt20 UTSW 3 54727671 small insertion probably benign
FR4737:Supt20 UTSW 3 54727657 small insertion probably benign
FR4737:Supt20 UTSW 3 54727658 small insertion probably benign
FR4737:Supt20 UTSW 3 54727661 small insertion probably benign
R0675:Supt20 UTSW 3 54706969 missense probably damaging 1.00
R0744:Supt20 UTSW 3 54714701 missense probably damaging 1.00
R0968:Supt20 UTSW 3 54708400 intron probably benign
R1075:Supt20 UTSW 3 54706941 nonsense probably null
R1689:Supt20 UTSW 3 54712162 nonsense probably null
R1772:Supt20 UTSW 3 54710420 missense probably damaging 1.00
R1779:Supt20 UTSW 3 54714743 missense probably benign 0.00
R1829:Supt20 UTSW 3 54727658 utr 3 prime probably benign
R3236:Supt20 UTSW 3 54709080 missense possibly damaging 0.94
R3237:Supt20 UTSW 3 54709080 missense possibly damaging 0.94
R4989:Supt20 UTSW 3 54695134 utr 5 prime probably benign
R5180:Supt20 UTSW 3 54709085 missense probably benign 0.00
R5188:Supt20 UTSW 3 54710428 missense possibly damaging 0.87
R5423:Supt20 UTSW 3 54709325 missense probably damaging 1.00
R5627:Supt20 UTSW 3 54713190 missense possibly damaging 0.86
R5888:Supt20 UTSW 3 54712207 missense probably benign
R5995:Supt20 UTSW 3 54709053 missense probably damaging 0.97
R6316:Supt20 UTSW 3 54727648 small insertion probably benign
R6623:Supt20 UTSW 3 54718294 missense possibly damaging 0.93
R6713:Supt20 UTSW 3 54698601 missense possibly damaging 0.89
R6874:Supt20 UTSW 3 54727754 intron probably null
R6988:Supt20 UTSW 3 54698597 missense probably damaging 1.00
R7149:Supt20 UTSW 3 54728411 missense unknown
R7592:Supt20 UTSW 3 54707122 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CGCAACACGTTCTTTCAGCACTACA -3'
(R):5'- ACTAACCAGTGCCACAAAAGGGATTAAA -3'

Sequencing Primer
(F):5'- cctcccccccccagttc -3'
(R):5'- cacacacacacacacacac -3'
Posted On2013-04-24