Incidental Mutation 'R3955:Olfr1259'
ID310631
Institutional Source Beutler Lab
Gene Symbol Olfr1259
Ensembl Gene ENSMUSG00000068806
Gene Nameolfactory receptor 1259
SynonymsGA_x6K02T2Q125-51376062-51375133, MOR232-9
MMRRC Submission 040832-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.524) question?
Stock #R3955 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location89940532-89948664 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 89943828 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 96 (M96L)
Ref Sequence ENSEMBL: ENSMUSP00000149652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090695] [ENSMUST00000214846]
Predicted Effect possibly damaging
Transcript: ENSMUST00000090695
AA Change: M96L

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000088194
Gene: ENSMUSG00000068806
AA Change: M96L

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 8.9e-45 PFAM
Pfam:7tm_1 39 285 5.5e-18 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214846
AA Change: M96L

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,068,073 T1008A probably benign Het
6030419C18Rik A T 9: 58,499,623 D272V probably damaging Het
Abcc5 G C 16: 20,405,543 H97D probably damaging Het
Acbd7 T C 2: 3,336,213 S2P probably benign Het
Acta2 G T 19: 34,251,726 probably benign Het
Adam2 G A 14: 66,057,610 S262L probably damaging Het
C130060K24Rik A T 6: 65,453,108 I263L possibly damaging Het
Cd69 A T 6: 129,268,380 probably null Het
Cpsf3 A G 12: 21,313,805 D632G probably benign Het
Dennd5a A G 7: 109,905,699 M868T probably benign Het
Dscc1 T C 15: 55,083,553 T259A probably benign Het
Dsg4 G A 18: 20,449,375 probably null Het
Fam58b C A 11: 78,751,023 E214* probably null Het
Gm996 G T 2: 25,577,571 S776* probably null Het
Igfn1 A G 1: 135,967,180 Y1883H possibly damaging Het
Krt20 G A 11: 99,432,211 Q262* probably null Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Lmod2 G T 6: 24,603,871 V282L probably benign Het
Lrrc49 A G 9: 60,671,359 I228T probably damaging Het
Matn1 G A 4: 130,951,415 probably null Het
Nek7 C A 1: 138,534,389 C79F probably damaging Het
Nmt2 A G 2: 3,312,498 D132G probably benign Het
Nup210l A T 3: 90,193,054 R1462S possibly damaging Het
Obscn G A 11: 59,036,768 S6118F probably damaging Het
Olfr1042 A G 2: 86,159,938 V144A probably benign Het
Olfr127 A T 17: 37,903,609 H21L probably benign Het
Olfr50 T A 2: 36,793,553 L106M probably benign Het
Olfr566 A G 7: 102,856,617 C222R probably damaging Het
Plxnb3 T C X: 73,771,220 V1789A probably benign Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Rab3gap1 A G 1: 127,934,517 Q675R probably damaging Het
Rasgrf2 A G 13: 91,982,855 S696P probably damaging Het
Sergef T A 7: 46,618,752 E210V possibly damaging Het
Sik3 C A 9: 46,198,593 N541K probably damaging Het
Slc26a1 T C 5: 108,673,582 D147G possibly damaging Het
Tbc1d14 G A 5: 36,543,215 R270* probably null Het
Tbc1d9 C T 8: 83,233,532 T138I probably damaging Het
Tdp2 C T 13: 24,836,099 T123I probably benign Het
Tec T C 5: 72,782,177 probably null Het
Tmf1 C A 6: 97,176,206 R302L probably damaging Het
Tnip3 A T 6: 65,597,395 T137S possibly damaging Het
Trim30d C T 7: 104,472,521 G339D probably damaging Het
Tspan32 T A 7: 143,006,998 M61K probably damaging Het
Ttc6 T C 12: 57,697,452 V1290A probably benign Het
Ttn A G 2: 76,969,249 V429A possibly damaging Het
Unc13b A G 4: 43,256,834 Y3962C probably damaging Het
Vmn2r95 T A 17: 18,440,096 Y257N possibly damaging Het
Zfp677 A G 17: 21,397,817 K379E possibly damaging Het
Zfp865 T A 7: 5,032,014 D999E probably damaging Het
Other mutations in Olfr1259
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Olfr1259 APN 2 89943260 missense probably damaging 0.96
IGL01446:Olfr1259 APN 2 89943938 missense probably damaging 0.99
IGL01830:Olfr1259 APN 2 89943431 missense probably benign 0.03
IGL02160:Olfr1259 APN 2 89943805 missense probably damaging 1.00
PIT4280001:Olfr1259 UTSW 2 89943743 missense probably damaging 1.00
R0366:Olfr1259 UTSW 2 89943818 missense possibly damaging 0.89
R0550:Olfr1259 UTSW 2 89943389 missense probably damaging 0.99
R0587:Olfr1259 UTSW 2 89943392 missense probably damaging 1.00
R1383:Olfr1259 UTSW 2 89943551 missense probably benign 0.12
R1400:Olfr1259 UTSW 2 89943542 missense possibly damaging 0.82
R1851:Olfr1259 UTSW 2 89943814 nonsense probably null
R1953:Olfr1259 UTSW 2 89943923 missense probably damaging 1.00
R2330:Olfr1259 UTSW 2 89943953 missense probably benign
R3897:Olfr1259 UTSW 2 89943809 missense probably benign 0.24
R4687:Olfr1259 UTSW 2 89943869 missense probably damaging 0.98
R4976:Olfr1259 UTSW 2 89943803 missense possibly damaging 0.77
R5119:Olfr1259 UTSW 2 89943803 missense possibly damaging 0.77
R5291:Olfr1259 UTSW 2 89943436 nonsense probably null
R5415:Olfr1259 UTSW 2 89943387 missense probably benign 0.25
R5546:Olfr1259 UTSW 2 89943585 missense probably damaging 1.00
R5588:Olfr1259 UTSW 2 89943792 missense probably benign 0.00
R6633:Olfr1259 UTSW 2 89943366 missense probably benign
R6858:Olfr1259 UTSW 2 89943743 missense probably damaging 0.99
R7294:Olfr1259 UTSW 2 89943724 nonsense probably null
R8261:Olfr1259 UTSW 2 89943372 missense probably benign 0.00
R8319:Olfr1259 UTSW 2 89943680 missense possibly damaging 0.87
Z1088:Olfr1259 UTSW 2 89943770 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GAAATCCTCCAGTCCAGGCTAC -3'
(R):5'- CCCCAAATGCAGAAAGTAGTG -3'

Sequencing Primer
(F):5'- GCTACCCCCACCAGGAGAATG -3'
(R):5'- CCCAAATGCAGAAAGTAGTGTTCGTG -3'
Posted On2015-04-29