Incidental Mutation 'R3955:Lmod2'
ID310639
Institutional Source Beutler Lab
Gene Symbol Lmod2
Ensembl Gene ENSMUSG00000029683
Gene Nameleiomodin 2 (cardiac)
SynonymsC-Lmod
MMRRC Submission 040832-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R3955 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location24597762-24605414 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 24603871 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 282 (V282L)
Ref Sequence ENSEMBL: ENSMUSP00000031694 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031694]
Predicted Effect probably benign
Transcript: ENSMUST00000031694
AA Change: V282L

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000031694
Gene: ENSMUSG00000029683
AA Change: V282L

DomainStartEndE-ValueType
Pfam:Tropomodulin 6 153 9.7e-19 PFAM
PDB:1IO0|A 202 360 5e-45 PDB
low complexity region 361 374 N/A INTRINSIC
low complexity region 403 414 N/A INTRINSIC
low complexity region 421 453 N/A INTRINSIC
low complexity region 482 490 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 100% (56/56)
MGI Phenotype PHENOTYPE: Homozygous disruption of this gene results in thin filaments in the heart, cardiac contractile dysfunction, abnormal myocardial fiber ultrastucture, dilated cardiomyopathy, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,068,073 T1008A probably benign Het
6030419C18Rik A T 9: 58,499,623 D272V probably damaging Het
Abcc5 G C 16: 20,405,543 H97D probably damaging Het
Acbd7 T C 2: 3,336,213 S2P probably benign Het
Acta2 G T 19: 34,251,726 probably benign Het
Adam2 G A 14: 66,057,610 S262L probably damaging Het
C130060K24Rik A T 6: 65,453,108 I263L possibly damaging Het
Cd69 A T 6: 129,268,380 probably null Het
Cpsf3 A G 12: 21,313,805 D632G probably benign Het
Dennd5a A G 7: 109,905,699 M868T probably benign Het
Dscc1 T C 15: 55,083,553 T259A probably benign Het
Dsg4 G A 18: 20,449,375 probably null Het
Fam58b C A 11: 78,751,023 E214* probably null Het
Gm996 G T 2: 25,577,571 S776* probably null Het
Igfn1 A G 1: 135,967,180 Y1883H possibly damaging Het
Krt20 G A 11: 99,432,211 Q262* probably null Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Lrrc49 A G 9: 60,671,359 I228T probably damaging Het
Matn1 G A 4: 130,951,415 probably null Het
Nek7 C A 1: 138,534,389 C79F probably damaging Het
Nmt2 A G 2: 3,312,498 D132G probably benign Het
Nup210l A T 3: 90,193,054 R1462S possibly damaging Het
Obscn G A 11: 59,036,768 S6118F probably damaging Het
Olfr1042 A G 2: 86,159,938 V144A probably benign Het
Olfr1259 T A 2: 89,943,828 M96L possibly damaging Het
Olfr127 A T 17: 37,903,609 H21L probably benign Het
Olfr50 T A 2: 36,793,553 L106M probably benign Het
Olfr566 A G 7: 102,856,617 C222R probably damaging Het
Plxnb3 T C X: 73,771,220 V1789A probably benign Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Rab3gap1 A G 1: 127,934,517 Q675R probably damaging Het
Rasgrf2 A G 13: 91,982,855 S696P probably damaging Het
Sergef T A 7: 46,618,752 E210V possibly damaging Het
Sik3 C A 9: 46,198,593 N541K probably damaging Het
Slc26a1 T C 5: 108,673,582 D147G possibly damaging Het
Tbc1d14 G A 5: 36,543,215 R270* probably null Het
Tbc1d9 C T 8: 83,233,532 T138I probably damaging Het
Tdp2 C T 13: 24,836,099 T123I probably benign Het
Tec T C 5: 72,782,177 probably null Het
Tmf1 C A 6: 97,176,206 R302L probably damaging Het
Tnip3 A T 6: 65,597,395 T137S possibly damaging Het
Trim30d C T 7: 104,472,521 G339D probably damaging Het
Tspan32 T A 7: 143,006,998 M61K probably damaging Het
Ttc6 T C 12: 57,697,452 V1290A probably benign Het
Ttn A G 2: 76,969,249 V429A possibly damaging Het
Unc13b A G 4: 43,256,834 Y3962C probably damaging Het
Vmn2r95 T A 17: 18,440,096 Y257N possibly damaging Het
Zfp677 A G 17: 21,397,817 K379E possibly damaging Het
Zfp865 T A 7: 5,032,014 D999E probably damaging Het
Other mutations in Lmod2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Lmod2 APN 6 24598052 missense probably damaging 1.00
IGL01013:Lmod2 APN 6 24604135 missense probably damaging 0.98
IGL02164:Lmod2 APN 6 24603910 missense possibly damaging 0.89
IGL02328:Lmod2 APN 6 24603833 missense probably benign 0.00
IGL02956:Lmod2 APN 6 24603632 missense probably damaging 1.00
IGL03213:Lmod2 APN 6 24603616 missense possibly damaging 0.88
IGL03351:Lmod2 APN 6 24598016 missense probably benign 0.00
P0035:Lmod2 UTSW 6 24597886 missense probably damaging 1.00
R1764:Lmod2 UTSW 6 24603377 missense probably damaging 0.99
R3104:Lmod2 UTSW 6 24604472 missense probably damaging 1.00
R4410:Lmod2 UTSW 6 24604630 missense probably damaging 1.00
R4876:Lmod2 UTSW 6 24604279 missense probably benign 0.06
R4957:Lmod2 UTSW 6 24603872 missense possibly damaging 0.63
R5509:Lmod2 UTSW 6 24603889 missense probably damaging 1.00
R5655:Lmod2 UTSW 6 24603854 missense possibly damaging 0.65
R6114:Lmod2 UTSW 6 24603692 missense probably damaging 1.00
R6462:Lmod2 UTSW 6 24604301 missense probably benign 0.06
R6834:Lmod2 UTSW 6 24597783 start gained probably benign
R6869:Lmod2 UTSW 6 24604127 missense probably benign 0.06
R6909:Lmod2 UTSW 6 24604158 missense probably benign 0.00
R6918:Lmod2 UTSW 6 24603595 missense probably benign 0.23
R7352:Lmod2 UTSW 6 24598111 missense possibly damaging 0.84
R7425:Lmod2 UTSW 6 24603476 missense probably benign
R7476:Lmod2 UTSW 6 24597921 nonsense probably null
R7986:Lmod2 UTSW 6 24603449 missense possibly damaging 0.65
R8417:Lmod2 UTSW 6 24603385 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- TCCCACTGTTATTGAGGATGC -3'
(R):5'- CTCAGCAGCGTGGTATTCTC -3'

Sequencing Primer
(F):5'- TGACCCTGATACGACAGAAGTTAATC -3'
(R):5'- CTTTGAGCAGCTTGACAATTTCC -3'
Posted On2015-04-29