Incidental Mutation 'R3955:Adam2'
ID310665
Institutional Source Beutler Lab
Gene Symbol Adam2
Ensembl Gene ENSMUSG00000022039
Gene Namea disintegrin and metallopeptidase domain 2
Synonymsfertilin beta, Ftnb, Ph30-beta
MMRRC Submission 040832-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3955 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location66027329-66077733 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 66057610 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 262 (S262L)
Ref Sequence ENSEMBL: ENSMUSP00000022618 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022618]
Predicted Effect probably damaging
Transcript: ENSMUST00000022618
AA Change: S262L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022618
Gene: ENSMUSG00000022039
AA Change: S262L

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 17 147 2.1e-26 PFAM
Pfam:Reprolysin 184 381 7.1e-73 PFAM
DISIN 398 474 1.21e-27 SMART
ACR 475 612 6.96e-62 SMART
transmembrane domain 687 709 N/A INTRINSIC
low complexity region 721 733 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225667
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. This gene is predominantly expressed in the epididymis, where the encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Male mice lacking the encoded protein are infertile and exhibit multiple defects in reproduction. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene are viable, females are fertile, but males have severely reduced fertility. Mutant male sperm are defective in sperm-egg membrane adhesion, sperm-egg fusion, migration from the uterus to theoviduct, and binding to the egg zona pellucida. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,068,073 T1008A probably benign Het
6030419C18Rik A T 9: 58,499,623 D272V probably damaging Het
Abcc5 G C 16: 20,405,543 H97D probably damaging Het
Acbd7 T C 2: 3,336,213 S2P probably benign Het
Acta2 G T 19: 34,251,726 probably benign Het
C130060K24Rik A T 6: 65,453,108 I263L possibly damaging Het
Cd69 A T 6: 129,268,380 probably null Het
Cpsf3 A G 12: 21,313,805 D632G probably benign Het
Dennd5a A G 7: 109,905,699 M868T probably benign Het
Dscc1 T C 15: 55,083,553 T259A probably benign Het
Dsg4 G A 18: 20,449,375 probably null Het
Fam58b C A 11: 78,751,023 E214* probably null Het
Gm996 G T 2: 25,577,571 S776* probably null Het
Igfn1 A G 1: 135,967,180 Y1883H possibly damaging Het
Krt20 G A 11: 99,432,211 Q262* probably null Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Lmod2 G T 6: 24,603,871 V282L probably benign Het
Lrrc49 A G 9: 60,671,359 I228T probably damaging Het
Matn1 G A 4: 130,951,415 probably null Het
Nek7 C A 1: 138,534,389 C79F probably damaging Het
Nmt2 A G 2: 3,312,498 D132G probably benign Het
Nup210l A T 3: 90,193,054 R1462S possibly damaging Het
Obscn G A 11: 59,036,768 S6118F probably damaging Het
Olfr1042 A G 2: 86,159,938 V144A probably benign Het
Olfr1259 T A 2: 89,943,828 M96L possibly damaging Het
Olfr127 A T 17: 37,903,609 H21L probably benign Het
Olfr50 T A 2: 36,793,553 L106M probably benign Het
Olfr566 A G 7: 102,856,617 C222R probably damaging Het
Plxnb3 T C X: 73,771,220 V1789A probably benign Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Rab3gap1 A G 1: 127,934,517 Q675R probably damaging Het
Rasgrf2 A G 13: 91,982,855 S696P probably damaging Het
Sergef T A 7: 46,618,752 E210V possibly damaging Het
Sik3 C A 9: 46,198,593 N541K probably damaging Het
Slc26a1 T C 5: 108,673,582 D147G possibly damaging Het
Tbc1d14 G A 5: 36,543,215 R270* probably null Het
Tbc1d9 C T 8: 83,233,532 T138I probably damaging Het
Tdp2 C T 13: 24,836,099 T123I probably benign Het
Tec T C 5: 72,782,177 probably null Het
Tmf1 C A 6: 97,176,206 R302L probably damaging Het
Tnip3 A T 6: 65,597,395 T137S possibly damaging Het
Trim30d C T 7: 104,472,521 G339D probably damaging Het
Tspan32 T A 7: 143,006,998 M61K probably damaging Het
Ttc6 T C 12: 57,697,452 V1290A probably benign Het
Ttn A G 2: 76,969,249 V429A possibly damaging Het
Unc13b A G 4: 43,256,834 Y3962C probably damaging Het
Vmn2r95 T A 17: 18,440,096 Y257N possibly damaging Het
Zfp677 A G 17: 21,397,817 K379E possibly damaging Het
Zfp865 T A 7: 5,032,014 D999E probably damaging Het
Other mutations in Adam2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Adam2 APN 14 66074049 critical splice donor site probably null
IGL00980:Adam2 APN 14 66056528 nonsense probably null
IGL01404:Adam2 APN 14 66077210 critical splice donor site probably null
IGL01901:Adam2 APN 14 66035229 splice site probably benign
IGL02687:Adam2 APN 14 66069190 missense probably damaging 1.00
IGL02692:Adam2 APN 14 66074087 missense probably damaging 1.00
IGL02695:Adam2 APN 14 66050480 missense probably benign 0.01
IGL02798:Adam2 APN 14 66040275 missense probably damaging 1.00
IGL03217:Adam2 APN 14 66034813 missense possibly damaging 0.85
IGL03256:Adam2 APN 14 66053831 missense probably benign 0.03
sacher UTSW 14 66068558 missense probably damaging 1.00
zuker UTSW 14 66059912 missense probably benign 0.14
R0092:Adam2 UTSW 14 66053887 missense probably damaging 1.00
R0281:Adam2 UTSW 14 66037606 missense probably benign 0.20
R0636:Adam2 UTSW 14 66034816 missense probably benign 0.03
R0690:Adam2 UTSW 14 66057646 missense probably damaging 1.00
R0727:Adam2 UTSW 14 66029731 missense probably damaging 1.00
R1477:Adam2 UTSW 14 66077700 missense possibly damaging 0.96
R1634:Adam2 UTSW 14 66057731 missense probably damaging 1.00
R1652:Adam2 UTSW 14 66077251 missense probably benign 0.41
R1717:Adam2 UTSW 14 66068558 missense probably damaging 1.00
R1868:Adam2 UTSW 14 66077658 missense probably damaging 0.99
R1915:Adam2 UTSW 14 66037557 missense possibly damaging 0.95
R3748:Adam2 UTSW 14 66059912 missense probably benign 0.14
R3953:Adam2 UTSW 14 66057610 missense probably damaging 1.00
R3954:Adam2 UTSW 14 66057610 missense probably damaging 1.00
R3956:Adam2 UTSW 14 66057610 missense probably damaging 1.00
R3957:Adam2 UTSW 14 66057610 missense probably damaging 1.00
R4091:Adam2 UTSW 14 66029723 missense probably damaging 0.97
R5673:Adam2 UTSW 14 66069232 missense probably benign 0.03
R5761:Adam2 UTSW 14 66046146 missense probably damaging 1.00
R6187:Adam2 UTSW 14 66068619 missense possibly damaging 0.89
R6499:Adam2 UTSW 14 66058790 missense probably damaging 1.00
R6730:Adam2 UTSW 14 66037576 missense possibly damaging 0.83
R6829:Adam2 UTSW 14 66027997 critical splice donor site probably null
R7023:Adam2 UTSW 14 66043056 missense probably benign 0.22
R7168:Adam2 UTSW 14 66058792 missense possibly damaging 0.89
R7228:Adam2 UTSW 14 66053912 nonsense probably null
R7293:Adam2 UTSW 14 66035185 missense probably benign 0.29
R7604:Adam2 UTSW 14 66056541 missense probably benign 0.17
R7765:Adam2 UTSW 14 66059896 missense probably damaging 1.00
R8380:Adam2 UTSW 14 66037557 missense probably benign 0.01
X0061:Adam2 UTSW 14 66053905 missense possibly damaging 0.66
Z1177:Adam2 UTSW 14 66056521 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTGTCCCAATAAGAGCTG -3'
(R):5'- TGACCTGAGCTTGATTTTGAAGC -3'

Sequencing Primer
(F):5'- TGTCCCAATAAGAGCTGCATGC -3'
(R):5'- TGAAGCTCTTTTGCCCGG -3'
Posted On2015-04-29