Incidental Mutation 'R3955:Dscc1'
ID310666
Institutional Source Beutler Lab
Gene Symbol Dscc1
Ensembl Gene ENSMUSG00000022422
Gene NameDNA replication and sister chromatid cohesion 1
Synonyms2600005O03Rik, 2010006I05Rik
MMRRC Submission 040832-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R3955 (G1)
Quality Score140
Status Validated
Chromosome15
Chromosomal Location55076099-55090491 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55083553 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 259 (T259A)
Ref Sequence ENSEMBL: ENSMUSP00000105860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023059] [ENSMUST00000110231]
Predicted Effect probably benign
Transcript: ENSMUST00000023059
SMART Domains Protein: ENSMUSP00000023059
Gene: ENSMUSG00000022422

DomainStartEndE-ValueType
low complexity region 38 47 N/A INTRINSIC
Pfam:DUF2036 48 364 7.3e-110 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110231
AA Change: T259A

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000105860
Gene: ENSMUSG00000022422
AA Change: T259A

DomainStartEndE-ValueType
low complexity region 38 47 N/A INTRINSIC
Pfam:DUF2036 49 271 5.9e-62 PFAM
Pfam:DUF2036 284 426 4.3e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143523
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228250
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CHTF18 (MIM 613201), CHTF8 (MIM 613202), and DSCC1 are components of an alternative replication factor C (RFC) (see MIM 600404) complex that loads PCNA (MIM 176740) onto DNA during S phase of the cell cycle (Merkle et al., 2003 [PubMed 12766176]; Bermudez et al., 2003 [PubMed 12930902]).[supplied by OMIM, Dec 2009]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,068,073 T1008A probably benign Het
6030419C18Rik A T 9: 58,499,623 D272V probably damaging Het
Abcc5 G C 16: 20,405,543 H97D probably damaging Het
Acbd7 T C 2: 3,336,213 S2P probably benign Het
Acta2 G T 19: 34,251,726 probably benign Het
Adam2 G A 14: 66,057,610 S262L probably damaging Het
C130060K24Rik A T 6: 65,453,108 I263L possibly damaging Het
Cd69 A T 6: 129,268,380 probably null Het
Cpsf3 A G 12: 21,313,805 D632G probably benign Het
Dennd5a A G 7: 109,905,699 M868T probably benign Het
Dsg4 G A 18: 20,449,375 probably null Het
Fam58b C A 11: 78,751,023 E214* probably null Het
Gm996 G T 2: 25,577,571 S776* probably null Het
Igfn1 A G 1: 135,967,180 Y1883H possibly damaging Het
Krt20 G A 11: 99,432,211 Q262* probably null Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Lmod2 G T 6: 24,603,871 V282L probably benign Het
Lrrc49 A G 9: 60,671,359 I228T probably damaging Het
Matn1 G A 4: 130,951,415 probably null Het
Nek7 C A 1: 138,534,389 C79F probably damaging Het
Nmt2 A G 2: 3,312,498 D132G probably benign Het
Nup210l A T 3: 90,193,054 R1462S possibly damaging Het
Obscn G A 11: 59,036,768 S6118F probably damaging Het
Olfr1042 A G 2: 86,159,938 V144A probably benign Het
Olfr1259 T A 2: 89,943,828 M96L possibly damaging Het
Olfr127 A T 17: 37,903,609 H21L probably benign Het
Olfr50 T A 2: 36,793,553 L106M probably benign Het
Olfr566 A G 7: 102,856,617 C222R probably damaging Het
Plxnb3 T C X: 73,771,220 V1789A probably benign Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Rab3gap1 A G 1: 127,934,517 Q675R probably damaging Het
Rasgrf2 A G 13: 91,982,855 S696P probably damaging Het
Sergef T A 7: 46,618,752 E210V possibly damaging Het
Sik3 C A 9: 46,198,593 N541K probably damaging Het
Slc26a1 T C 5: 108,673,582 D147G possibly damaging Het
Tbc1d14 G A 5: 36,543,215 R270* probably null Het
Tbc1d9 C T 8: 83,233,532 T138I probably damaging Het
Tdp2 C T 13: 24,836,099 T123I probably benign Het
Tec T C 5: 72,782,177 probably null Het
Tmf1 C A 6: 97,176,206 R302L probably damaging Het
Tnip3 A T 6: 65,597,395 T137S possibly damaging Het
Trim30d C T 7: 104,472,521 G339D probably damaging Het
Tspan32 T A 7: 143,006,998 M61K probably damaging Het
Ttc6 T C 12: 57,697,452 V1290A probably benign Het
Ttn A G 2: 76,969,249 V429A possibly damaging Het
Unc13b A G 4: 43,256,834 Y3962C probably damaging Het
Vmn2r95 T A 17: 18,440,096 Y257N possibly damaging Het
Zfp677 A G 17: 21,397,817 K379E possibly damaging Het
Zfp865 T A 7: 5,032,014 D999E probably damaging Het
Other mutations in Dscc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01121:Dscc1 APN 15 55082325 splice site probably benign
IGL01879:Dscc1 APN 15 55086816 missense probably benign 0.21
BB001:Dscc1 UTSW 15 55082176 missense probably benign 0.03
BB011:Dscc1 UTSW 15 55082176 missense probably benign 0.03
PIT4498001:Dscc1 UTSW 15 55082315 missense probably benign 0.00
PIT4812001:Dscc1 UTSW 15 55082261 missense probably damaging 1.00
R0106:Dscc1 UTSW 15 55083570 missense probably benign 0.10
R0106:Dscc1 UTSW 15 55083570 missense probably benign 0.10
R0594:Dscc1 UTSW 15 55089052 missense possibly damaging 0.69
R0616:Dscc1 UTSW 15 55083570 missense probably benign 0.10
R1458:Dscc1 UTSW 15 55086764 missense probably damaging 1.00
R1498:Dscc1 UTSW 15 55080176 splice site probably benign
R1763:Dscc1 UTSW 15 55080176 splice site probably benign
R1763:Dscc1 UTSW 15 55084139 missense probably damaging 0.98
R1985:Dscc1 UTSW 15 55080176 splice site probably benign
R2418:Dscc1 UTSW 15 55083424 nonsense probably null
R2419:Dscc1 UTSW 15 55083424 nonsense probably null
R4773:Dscc1 UTSW 15 55080258 missense probably benign 0.01
R5611:Dscc1 UTSW 15 55082173 missense probably benign 0.23
R6484:Dscc1 UTSW 15 55080290 nonsense probably null
R7562:Dscc1 UTSW 15 55084185 missense probably benign 0.15
R7662:Dscc1 UTSW 15 55076165 missense possibly damaging 0.95
R7924:Dscc1 UTSW 15 55082176 missense probably benign 0.03
Z1088:Dscc1 UTSW 15 55080317 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- GATGGTGCAGACGTATTCACC -3'
(R):5'- CCTCTGCAGATTTCTTTAAGACAGTG -3'

Sequencing Primer
(F):5'- GTGCAGACGTATTCACCTCAGTG -3'
(R):5'- GACAGTGAACACCTTGGAGTCATTC -3'
Posted On2015-04-29