Incidental Mutation 'R3955:Vmn2r95'
ID310668
Institutional Source Beutler Lab
Gene Symbol Vmn2r95
Ensembl Gene ENSMUSG00000091631
Gene Namevomeronasal 2, receptor 95
Synonyms
MMRRC Submission 040832-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.352) question?
Stock #R3955 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location18424078-18460905 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 18440096 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 257 (Y257N)
Ref Sequence ENSEMBL: ENSMUSP00000156383 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166327] [ENSMUST00000232090] [ENSMUST00000232464]
Predicted Effect probably benign
Transcript: ENSMUST00000166327
AA Change: Y257N

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000126106
Gene: ENSMUSG00000091631
AA Change: Y257N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 462 1.8e-35 PFAM
Pfam:NCD3G 509 562 3.2e-20 PFAM
Pfam:7tm_3 594 830 3.2e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000232090
AA Change: Y257N

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect possibly damaging
Transcript: ENSMUST00000232464
AA Change: Y257N

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,068,073 T1008A probably benign Het
6030419C18Rik A T 9: 58,499,623 D272V probably damaging Het
Abcc5 G C 16: 20,405,543 H97D probably damaging Het
Acbd7 T C 2: 3,336,213 S2P probably benign Het
Acta2 G T 19: 34,251,726 probably benign Het
Adam2 G A 14: 66,057,610 S262L probably damaging Het
C130060K24Rik A T 6: 65,453,108 I263L possibly damaging Het
Cd69 A T 6: 129,268,380 probably null Het
Cpsf3 A G 12: 21,313,805 D632G probably benign Het
Dennd5a A G 7: 109,905,699 M868T probably benign Het
Dscc1 T C 15: 55,083,553 T259A probably benign Het
Dsg4 G A 18: 20,449,375 probably null Het
Fam58b C A 11: 78,751,023 E214* probably null Het
Gm996 G T 2: 25,577,571 S776* probably null Het
Igfn1 A G 1: 135,967,180 Y1883H possibly damaging Het
Krt20 G A 11: 99,432,211 Q262* probably null Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Lmod2 G T 6: 24,603,871 V282L probably benign Het
Lrrc49 A G 9: 60,671,359 I228T probably damaging Het
Matn1 G A 4: 130,951,415 probably null Het
Nek7 C A 1: 138,534,389 C79F probably damaging Het
Nmt2 A G 2: 3,312,498 D132G probably benign Het
Nup210l A T 3: 90,193,054 R1462S possibly damaging Het
Obscn G A 11: 59,036,768 S6118F probably damaging Het
Olfr1042 A G 2: 86,159,938 V144A probably benign Het
Olfr1259 T A 2: 89,943,828 M96L possibly damaging Het
Olfr127 A T 17: 37,903,609 H21L probably benign Het
Olfr50 T A 2: 36,793,553 L106M probably benign Het
Olfr566 A G 7: 102,856,617 C222R probably damaging Het
Plxnb3 T C X: 73,771,220 V1789A probably benign Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Rab3gap1 A G 1: 127,934,517 Q675R probably damaging Het
Rasgrf2 A G 13: 91,982,855 S696P probably damaging Het
Sergef T A 7: 46,618,752 E210V possibly damaging Het
Sik3 C A 9: 46,198,593 N541K probably damaging Het
Slc26a1 T C 5: 108,673,582 D147G possibly damaging Het
Tbc1d14 G A 5: 36,543,215 R270* probably null Het
Tbc1d9 C T 8: 83,233,532 T138I probably damaging Het
Tdp2 C T 13: 24,836,099 T123I probably benign Het
Tec T C 5: 72,782,177 probably null Het
Tmf1 C A 6: 97,176,206 R302L probably damaging Het
Tnip3 A T 6: 65,597,395 T137S possibly damaging Het
Trim30d C T 7: 104,472,521 G339D probably damaging Het
Tspan32 T A 7: 143,006,998 M61K probably damaging Het
Ttc6 T C 12: 57,697,452 V1290A probably benign Het
Ttn A G 2: 76,969,249 V429A possibly damaging Het
Unc13b A G 4: 43,256,834 Y3962C probably damaging Het
Zfp677 A G 17: 21,397,817 K379E possibly damaging Het
Zfp865 T A 7: 5,032,014 D999E probably damaging Het
Other mutations in Vmn2r95
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Vmn2r95 APN 17 18452328 utr 3 prime probably benign
IGL01479:Vmn2r95 APN 17 18443862 missense probably damaging 1.00
IGL01890:Vmn2r95 APN 17 18451475 missense probably damaging 1.00
IGL01986:Vmn2r95 APN 17 18440211 missense probably benign 0.06
IGL02113:Vmn2r95 APN 17 18439907 missense possibly damaging 0.47
IGL02154:Vmn2r95 APN 17 18451986 missense probably benign 0.16
IGL02190:Vmn2r95 APN 17 18451776 missense probably benign 0.00
IGL02412:Vmn2r95 APN 17 18439956 missense probably damaging 1.00
IGL02550:Vmn2r95 APN 17 18451732 missense probably damaging 1.00
IGL02679:Vmn2r95 APN 17 18443854 missense probably damaging 1.00
IGL02691:Vmn2r95 APN 17 18451858 missense probably benign 0.07
IGL02990:Vmn2r95 APN 17 18452036 nonsense probably null
IGL03032:Vmn2r95 APN 17 18452313 missense probably benign 0.00
R0416:Vmn2r95 UTSW 17 18441402 missense probably damaging 1.00
R0448:Vmn2r95 UTSW 17 18451743 missense possibly damaging 0.92
R0514:Vmn2r95 UTSW 17 18451582 missense probably benign
R0519:Vmn2r95 UTSW 17 18439503 missense probably damaging 1.00
R0539:Vmn2r95 UTSW 17 18452100 missense probably damaging 1.00
R1501:Vmn2r95 UTSW 17 18439856 missense probably damaging 0.99
R1598:Vmn2r95 UTSW 17 18452313 missense probably benign 0.03
R1613:Vmn2r95 UTSW 17 18440639 splice site probably benign
R1861:Vmn2r95 UTSW 17 18452268 missense probably damaging 1.00
R1921:Vmn2r95 UTSW 17 18424313 missense probably benign 0.11
R1986:Vmn2r95 UTSW 17 18451543 missense probably benign
R2031:Vmn2r95 UTSW 17 18439455 missense possibly damaging 0.94
R2040:Vmn2r95 UTSW 17 18441299 missense probably damaging 1.00
R3608:Vmn2r95 UTSW 17 18439973 missense possibly damaging 0.47
R3727:Vmn2r95 UTSW 17 18441482 nonsense probably null
R3953:Vmn2r95 UTSW 17 18440096 missense possibly damaging 0.79
R3957:Vmn2r95 UTSW 17 18440096 missense possibly damaging 0.79
R4474:Vmn2r95 UTSW 17 18452245 missense probably damaging 1.00
R4672:Vmn2r95 UTSW 17 18452151 missense probably damaging 1.00
R4850:Vmn2r95 UTSW 17 18451653 missense probably damaging 1.00
R5054:Vmn2r95 UTSW 17 18451446 missense possibly damaging 0.63
R5178:Vmn2r95 UTSW 17 18440075 missense probably benign 0.01
R5980:Vmn2r95 UTSW 17 18441362 missense probably benign
R6183:Vmn2r95 UTSW 17 18443930 missense probably damaging 0.99
R6276:Vmn2r95 UTSW 17 18451470 missense possibly damaging 0.96
R6651:Vmn2r95 UTSW 17 18440360 missense probably damaging 1.00
R6682:Vmn2r95 UTSW 17 18440227 missense probably damaging 1.00
R6797:Vmn2r95 UTSW 17 18452289 utr 3 prime probably benign
R6799:Vmn2r95 UTSW 17 18439293 missense probably damaging 1.00
R6849:Vmn2r95 UTSW 17 18443919 missense probably damaging 1.00
R6849:Vmn2r95 UTSW 17 18443920 missense probably damaging 1.00
R6982:Vmn2r95 UTSW 17 18452061 missense probably damaging 1.00
R7203:Vmn2r95 UTSW 17 18441315 missense probably benign 0.01
R7226:Vmn2r95 UTSW 17 18451983 missense possibly damaging 0.90
R7240:Vmn2r95 UTSW 17 18451963 missense probably benign 0.15
R7383:Vmn2r95 UTSW 17 18440472 missense probably benign 0.06
R7614:Vmn2r95 UTSW 17 18440090 missense probably benign
R7755:Vmn2r95 UTSW 17 18424105 start codon destroyed probably null 0.99
Z1088:Vmn2r95 UTSW 17 18440401 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CAGTATCCTTCTCTCTACCAGATGG -3'
(R):5'- GGCTTCCATGGAATGAGTCTAAC -3'

Sequencing Primer
(F):5'- AAGGACACATCTCTTTCACTTGC -3'
(R):5'- GAGTCTAACATGAAATAGTCAGCTC -3'
Posted On2015-04-29