Incidental Mutation 'R0383:Gpatch3'
ID 31068
Institutional Source Beutler Lab
Gene Symbol Gpatch3
Ensembl Gene ENSMUSG00000028850
Gene Name G patch domain containing 3
Synonyms Gpatc3, D930035B09Rik
MMRRC Submission 038589-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.074) question?
Stock # R0383 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 133302056-133311553 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 133305457 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 231 (R231S)
Ref Sequence ENSEMBL: ENSMUSP00000030662 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030662]
AlphaFold Q8BIY1
Predicted Effect probably damaging
Transcript: ENSMUST00000030662
AA Change: R231S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030662
Gene: ENSMUSG00000028850
AA Change: R231S

DomainStartEndE-ValueType
low complexity region 83 97 N/A INTRINSIC
low complexity region 274 305 N/A INTRINSIC
G_patch 409 457 1.3e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154648
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 88.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730455P16Rik G T 11: 80,254,767 (GRCm39) Y351* probably null Het
Aadac G T 3: 59,943,368 (GRCm39) R91L possibly damaging Het
Adgrg1 T A 8: 95,738,370 (GRCm39) F621Y probably damaging Het
Ankmy1 G T 1: 92,812,775 (GRCm39) D511E probably benign Het
Anks4b A T 7: 119,782,097 (GRCm39) D376V probably damaging Het
Aox1 G T 1: 58,100,400 (GRCm39) C399F probably benign Het
Arfgef1 C T 1: 10,269,067 (GRCm39) probably null Het
Arhgef4 G A 1: 34,849,614 (GRCm39) V546M probably damaging Het
Cab39 T A 1: 85,765,020 (GRCm39) V98E probably damaging Het
Cacna1b T C 2: 24,651,856 (GRCm39) N108D probably damaging Het
Car15 C A 16: 17,654,617 (GRCm39) E134* probably null Het
Ccdc80 T G 16: 44,915,732 (GRCm39) Y163D probably damaging Het
Cdcp3 A G 7: 130,841,268 (GRCm39) M537V probably benign Het
Col22a1 C T 15: 71,740,853 (GRCm39) G513D unknown Het
Col8a1 T C 16: 57,452,805 (GRCm39) D66G probably damaging Het
Crot C A 5: 9,018,734 (GRCm39) S544I probably damaging Het
Cubn G T 2: 13,435,770 (GRCm39) P1062Q probably damaging Het
Dcc A T 18: 71,553,334 (GRCm39) V774E probably damaging Het
Dlgap5 T A 14: 47,647,818 (GRCm39) M240L probably benign Het
Dlx4 A G 11: 95,036,261 (GRCm39) V16A probably benign Het
Dnah17 G T 11: 117,958,373 (GRCm39) H2703Q probably benign Het
Duox2 A G 2: 122,122,291 (GRCm39) probably null Het
Fn1 C T 1: 71,636,844 (GRCm39) V168I probably damaging Het
Fpr-rs4 A T 17: 18,242,359 (GRCm39) D122V probably damaging Het
Gas2l2 A T 11: 83,313,923 (GRCm39) I463N probably benign Het
Ggta1 G T 2: 35,292,416 (GRCm39) P297Q probably damaging Het
Gpc1 T C 1: 92,782,705 (GRCm39) Y151H probably damaging Het
Gpr141b A G 13: 19,913,317 (GRCm39) noncoding transcript Het
Gtf2e2 T C 8: 34,245,973 (GRCm39) W119R probably damaging Het
H2-M10.2 T C 17: 36,595,253 (GRCm39) I304V probably benign Het
Helq T C 5: 100,927,031 (GRCm39) K685R probably benign Het
Hps5 C T 7: 46,418,712 (GRCm39) probably null Het
Iars1 T C 13: 49,885,818 (GRCm39) C1186R probably damaging Het
Ift43 T C 12: 86,208,795 (GRCm39) V158A possibly damaging Het
Ift70b A G 2: 75,768,586 (GRCm39) Y56H probably damaging Het
Iqca1 A T 1: 90,070,429 (GRCm39) I141N probably damaging Het
Kat6b A G 14: 21,719,149 (GRCm39) N1276S probably benign Het
Kif19a A T 11: 114,656,340 (GRCm39) M1L possibly damaging Het
Kif1b T G 4: 149,286,969 (GRCm39) H1241P probably damaging Het
Kif26a T C 12: 112,144,510 (GRCm39) V1588A possibly damaging Het
Klb T A 5: 65,529,842 (GRCm39) probably null Het
Krtap26-1 A T 16: 88,444,131 (GRCm39) Y163* probably null Het
Lefty1 G T 1: 180,765,199 (GRCm39) E256* probably null Het
Lox T C 18: 52,662,271 (GRCm39) N44S possibly damaging Het
Marf1 C T 16: 13,960,398 (GRCm39) A549T probably damaging Het
Mctp1 A G 13: 76,949,663 (GRCm39) Y565C probably damaging Het
Megf6 C T 4: 154,349,783 (GRCm39) A961V probably benign Het
Mindy4 A G 6: 55,253,619 (GRCm39) K496R probably benign Het
Nalcn A T 14: 123,744,971 (GRCm39) H352Q probably benign Het
Ncoa5 T C 2: 164,851,310 (GRCm39) I188V possibly damaging Het
Notum G T 11: 120,545,282 (GRCm39) H426N probably benign Het
Or52r1 T A 7: 102,536,458 (GRCm39) I301F possibly damaging Het
Orm2 A T 4: 63,282,233 (GRCm39) D137V probably damaging Het
Pabpc2 G A 18: 39,908,448 (GRCm39) G571D probably damaging Het
Pabpc4 A G 4: 123,191,735 (GRCm39) N599S probably damaging Het
Pak1ip1 T C 13: 41,166,080 (GRCm39) V335A probably benign Het
Pcdhb11 A C 18: 37,556,446 (GRCm39) D592A probably damaging Het
Pmch C A 10: 87,927,120 (GRCm39) T41K possibly damaging Het
Polb G T 8: 23,130,011 (GRCm39) S187* probably null Het
Pter G T 2: 13,005,753 (GRCm39) G309* probably null Het
Ptprg T C 14: 12,219,024 (GRCm38) V406A possibly damaging Het
Ranbp3l A T 15: 9,063,184 (GRCm39) E467V possibly damaging Het
Rif1 T A 2: 51,975,153 (GRCm39) M354K probably damaging Het
Ripk4 C T 16: 97,549,312 (GRCm39) C248Y probably damaging Het
Slc6a15 T C 10: 103,253,914 (GRCm39) W617R probably damaging Het
Smyd5 C T 6: 85,417,155 (GRCm39) Q178* probably null Het
St18 T A 1: 6,873,248 (GRCm39) F328I probably damaging Het
Supt20 T A 3: 54,610,570 (GRCm39) L124* probably null Het
Tarbp1 T A 8: 127,174,223 (GRCm39) H861L probably benign Het
Tars1 A G 15: 11,390,411 (GRCm39) M356T probably benign Het
Tbc1d10a A G 11: 4,162,819 (GRCm39) T221A probably damaging Het
Tead3 A G 17: 28,553,672 (GRCm39) probably null Het
Tprg1 A G 16: 25,240,985 (GRCm39) T254A probably damaging Het
Trank1 C A 9: 111,220,545 (GRCm39) N2427K probably benign Het
Tufm T C 7: 126,089,036 (GRCm39) S380P probably damaging Het
Tyrobp C T 7: 30,114,042 (GRCm39) R68C probably damaging Het
Ubl4b T C 3: 107,462,143 (GRCm39) E39G possibly damaging Het
Uggt2 A T 14: 119,286,863 (GRCm39) F661I probably damaging Het
Upf3b A G X: 36,368,120 (GRCm39) I144T probably benign Het
Usp54 A T 14: 20,611,320 (GRCm39) D1165E probably benign Het
Vmn2r81 C T 10: 79,129,281 (GRCm39) T724I possibly damaging Het
Vsig1 A G X: 139,837,062 (GRCm39) I247M possibly damaging Het
Zfp110 C A 7: 12,583,187 (GRCm39) L612I probably benign Het
Zfp318 C A 17: 46,724,222 (GRCm39) T2075K probably damaging Het
Zfp37 A G 4: 62,110,122 (GRCm39) M1T probably null Het
Zfp605 T A 5: 110,276,720 (GRCm39) C613S probably damaging Het
Zfp729a G A 13: 67,769,792 (GRCm39) P146S possibly damaging Het
Zfp85 T C 13: 67,896,791 (GRCm39) N427S probably benign Het
Other mutations in Gpatch3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01590:Gpatch3 APN 4 133,308,028 (GRCm39) unclassified probably benign
IGL02876:Gpatch3 APN 4 133,307,995 (GRCm39) missense probably damaging 1.00
IGL03181:Gpatch3 APN 4 133,305,433 (GRCm39) missense probably damaging 1.00
ANU23:Gpatch3 UTSW 4 133,305,613 (GRCm39) small deletion probably benign
PIT4585001:Gpatch3 UTSW 4 133,310,397 (GRCm39) missense probably damaging 0.99
R0358:Gpatch3 UTSW 4 133,305,215 (GRCm39) splice site probably null
R1706:Gpatch3 UTSW 4 133,302,484 (GRCm39) nonsense probably null
R2269:Gpatch3 UTSW 4 133,311,118 (GRCm39) missense possibly damaging 0.83
R3788:Gpatch3 UTSW 4 133,302,479 (GRCm39) missense possibly damaging 0.93
R4030:Gpatch3 UTSW 4 133,305,458 (GRCm39) missense possibly damaging 0.94
R4334:Gpatch3 UTSW 4 133,309,792 (GRCm39) missense probably damaging 1.00
R4718:Gpatch3 UTSW 4 133,309,855 (GRCm39) missense probably benign 0.37
R5036:Gpatch3 UTSW 4 133,305,461 (GRCm39) missense probably damaging 1.00
R6032:Gpatch3 UTSW 4 133,305,617 (GRCm39) missense probably benign 0.06
R6032:Gpatch3 UTSW 4 133,305,617 (GRCm39) missense probably benign 0.06
R6572:Gpatch3 UTSW 4 133,302,191 (GRCm39) missense probably damaging 1.00
R6923:Gpatch3 UTSW 4 133,309,836 (GRCm39) missense probably damaging 1.00
R7106:Gpatch3 UTSW 4 133,305,514 (GRCm39) missense probably benign 0.05
R7572:Gpatch3 UTSW 4 133,302,117 (GRCm39) missense probably benign 0.01
R7737:Gpatch3 UTSW 4 133,302,407 (GRCm39) missense probably benign 0.01
R7937:Gpatch3 UTSW 4 133,310,308 (GRCm39) missense probably damaging 0.98
R8300:Gpatch3 UTSW 4 133,307,140 (GRCm39) missense probably damaging 1.00
R9541:Gpatch3 UTSW 4 133,305,595 (GRCm39) missense probably benign 0.01
RF025:Gpatch3 UTSW 4 133,305,621 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- CTTTTACCCTGGCTGACCTGAAGC -3'
(R):5'- AATTTCACAGTCACTGTCGGAGAGC -3'

Sequencing Primer
(F):5'- CTGACCTGAAGCAGCTCC -3'
(R):5'- tcctcttgcctccatctcc -3'
Posted On 2013-04-24