Incidental Mutation 'R3956:Gm8882'
ID310693
Institutional Source Beutler Lab
Gene Symbol Gm8882
Ensembl Gene ENSMUSG00000030143
Gene Namepredicted gene 8882
Synonyms
MMRRC Submission 040833-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R3956 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location132361041-132364134 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 132361851 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 135 (Q135K)
Ref Sequence ENSEMBL: ENSMUSP00000079660 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080849]
Predicted Effect unknown
Transcript: ENSMUST00000080849
AA Change: Q135K
SMART Domains Protein: ENSMUSP00000079660
Gene: ENSMUSG00000030143
AA Change: Q135K

DomainStartEndE-ValueType
Pfam:Pro-rich 1 118 2.2e-32 PFAM
Pfam:Pro-rich 155 228 6.3e-14 PFAM
Pfam:Pro-rich 211 277 5.8e-10 PFAM
Meta Mutation Damage Score 0.1552 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.5%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik A G 13: 58,384,389 S118P probably damaging Het
9330159F19Rik A G 10: 29,224,809 K393E possibly damaging Het
Aagab A G 9: 63,619,160 E155G probably damaging Het
Abca16 A G 7: 120,527,752 N1221S probably damaging Het
Acad11 A G 9: 104,086,152 probably benign Het
Acsl1 T A 8: 46,534,458 L693Q probably damaging Het
Adam2 G A 14: 66,057,610 S262L probably damaging Het
B3gat1 A G 9: 26,757,028 T305A possibly damaging Het
BC051076 A G 5: 87,964,251 noncoding transcript Het
Ccni A G 5: 93,183,404 L236S probably damaging Het
Cdc45 A G 16: 18,805,430 V119A probably benign Het
Clspn ACGGCGGCGGC A 4: 126,566,437 probably null Het
Creld1 A G 6: 113,492,229 D340G possibly damaging Het
Dnah2 T A 11: 69,484,021 I1417L probably benign Het
Efhc1 A C 1: 20,978,666 K434N probably damaging Het
Evi5l T C 8: 4,191,358 V297A possibly damaging Het
Fam49b T C 15: 63,941,974 Y158C probably damaging Het
Fam58b C A 11: 78,751,023 E214* probably null Het
Fam69b C T 2: 26,635,567 P171L probably benign Het
Fkbp8 T G 8: 70,534,867 S376A probably damaging Het
Gfod1 A T 13: 43,201,062 C146S probably damaging Het
Gm960 T A 19: 4,692,497 T214S probably benign Het
Greb1 G T 12: 16,682,299 P1554T probably damaging Het
Grip1 A T 10: 119,930,026 I88F probably damaging Het
Hbq1a T C 11: 32,300,214 probably null Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Kmt2e A G 5: 23,496,025 T121A probably benign Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Mfsd2b A T 12: 4,866,848 F194Y probably damaging Het
Mtmr3 A T 11: 4,491,138 V504E probably damaging Het
Neb C T 2: 52,201,963 V5030M possibly damaging Het
Nup210l A T 3: 90,193,054 R1462S possibly damaging Het
Olfr1039 C T 2: 86,131,019 V215I probably benign Het
Olfr1042 A G 2: 86,159,938 V144A probably benign Het
Olfr199 G A 16: 59,216,065 Q183* probably null Het
Pmfbp1 A G 8: 109,530,169 S502G probably benign Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Ralgapa2 C T 2: 146,435,964 V426I probably damaging Het
Rasgrf2 A G 13: 91,982,855 S696P probably damaging Het
Riok3 T A 18: 12,142,974 Y242* probably null Het
Robo2 T G 16: 73,961,867 Y672S probably damaging Het
Rsbn1 A G 3: 103,928,675 H343R probably damaging Het
Sar1a A T 10: 61,686,393 N88I possibly damaging Het
Sgcz A G 8: 37,526,192 probably benign Het
Tbc1d9 C T 8: 83,233,532 T138I probably damaging Het
Tex37 A G 6: 70,913,485 Y108H possibly damaging Het
Tmem131l C A 3: 83,910,419 C1257F probably damaging Het
Tmem136 C A 9: 43,111,513 C182F probably damaging Het
Ttn A G 2: 76,969,249 V429A possibly damaging Het
Umodl1 A G 17: 31,002,863 T1280A probably benign Het
Xpnpep3 A G 15: 81,451,029 probably benign Het
Other mutations in Gm8882
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02797:Gm8882 APN 6 132363045 critical splice acceptor site probably null
IGL02961:Gm8882 APN 6 132361408 missense unknown
R0334:Gm8882 UTSW 6 132364058 missense unknown
R1167:Gm8882 UTSW 6 132361590 missense unknown
R1635:Gm8882 UTSW 6 132363006 critical splice donor site probably null
R4734:Gm8882 UTSW 6 132361928 missense unknown
R5275:Gm8882 UTSW 6 132361877 missense unknown
R5295:Gm8882 UTSW 6 132361877 missense unknown
R5506:Gm8882 UTSW 6 132361856 missense unknown
R5580:Gm8882 UTSW 6 132361469 missense unknown
R5975:Gm8882 UTSW 6 132362073 missense unknown
R6503:Gm8882 UTSW 6 132361692 nonsense probably null
R8110:Gm8882 UTSW 6 132361568 missense unknown
Predicted Primers PCR Primer
(F):5'- CCTTGTTGGTTTCCAGGCCTAG -3'
(R):5'- TTTCCAAAACCACCTCCTGGAG -3'

Sequencing Primer
(F):5'- TTTCCAGGCCTAGGAGGTC -3'
(R):5'- GACCTCCCAGTTCTGATGAAAATG -3'
Posted On2015-04-29