Incidental Mutation 'R3956:Klk14'
ID310695
Institutional Source Beutler Lab
Gene Symbol Klk14
Ensembl Gene ENSMUSG00000044737
Gene Namekallikrein related-peptidase 14
Synonyms
MMRRC Submission 040833-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3956 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location43690418-43695536 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 43692077 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 51 (C51Y)
Ref Sequence ENSEMBL: ENSMUSP00000056935 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056329]
Predicted Effect probably damaging
Transcript: ENSMUST00000056329
AA Change: C51Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056935
Gene: ENSMUSG00000044737
AA Change: C51Y

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Tryp_SPc 23 243 2.02e-93 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181454
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205416
Meta Mutation Damage Score 0.7935 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.5%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: This gene encodes a member of the kallikrein subfamily of serine proteases that have diverse physiological functions such as regulation of blood pressure and desquamation. The encoded protein is a precursor that undergoes proteolytic cleavage of the activation peptide to generate the functional enzyme. The encoded enzyme was found to activate the complement pathway by cleavage of C3 to release C3a anaphylotoxin. This gene is one of the several glandular kallikrein genes located in a cluster on chromosome 7. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik A G 13: 58,384,389 S118P probably damaging Het
9330159F19Rik A G 10: 29,224,809 K393E possibly damaging Het
Aagab A G 9: 63,619,160 E155G probably damaging Het
Abca16 A G 7: 120,527,752 N1221S probably damaging Het
Acad11 A G 9: 104,086,152 probably benign Het
Acsl1 T A 8: 46,534,458 L693Q probably damaging Het
Adam2 G A 14: 66,057,610 S262L probably damaging Het
B3gat1 A G 9: 26,757,028 T305A possibly damaging Het
BC051076 A G 5: 87,964,251 noncoding transcript Het
Ccni A G 5: 93,183,404 L236S probably damaging Het
Cdc45 A G 16: 18,805,430 V119A probably benign Het
Clspn ACGGCGGCGGC A 4: 126,566,437 probably null Het
Creld1 A G 6: 113,492,229 D340G possibly damaging Het
Dnah2 T A 11: 69,484,021 I1417L probably benign Het
Efhc1 A C 1: 20,978,666 K434N probably damaging Het
Evi5l T C 8: 4,191,358 V297A possibly damaging Het
Fam49b T C 15: 63,941,974 Y158C probably damaging Het
Fam58b C A 11: 78,751,023 E214* probably null Het
Fam69b C T 2: 26,635,567 P171L probably benign Het
Fkbp8 T G 8: 70,534,867 S376A probably damaging Het
Gfod1 A T 13: 43,201,062 C146S probably damaging Het
Gm8882 G T 6: 132,361,851 Q135K unknown Het
Gm960 T A 19: 4,692,497 T214S probably benign Het
Greb1 G T 12: 16,682,299 P1554T probably damaging Het
Grip1 A T 10: 119,930,026 I88F probably damaging Het
Hbq1a T C 11: 32,300,214 probably null Het
Kmt2e A G 5: 23,496,025 T121A probably benign Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Mfsd2b A T 12: 4,866,848 F194Y probably damaging Het
Mtmr3 A T 11: 4,491,138 V504E probably damaging Het
Neb C T 2: 52,201,963 V5030M possibly damaging Het
Nup210l A T 3: 90,193,054 R1462S possibly damaging Het
Olfr1039 C T 2: 86,131,019 V215I probably benign Het
Olfr1042 A G 2: 86,159,938 V144A probably benign Het
Olfr199 G A 16: 59,216,065 Q183* probably null Het
Pmfbp1 A G 8: 109,530,169 S502G probably benign Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Ralgapa2 C T 2: 146,435,964 V426I probably damaging Het
Rasgrf2 A G 13: 91,982,855 S696P probably damaging Het
Riok3 T A 18: 12,142,974 Y242* probably null Het
Robo2 T G 16: 73,961,867 Y672S probably damaging Het
Rsbn1 A G 3: 103,928,675 H343R probably damaging Het
Sar1a A T 10: 61,686,393 N88I possibly damaging Het
Sgcz A G 8: 37,526,192 probably benign Het
Tbc1d9 C T 8: 83,233,532 T138I probably damaging Het
Tex37 A G 6: 70,913,485 Y108H possibly damaging Het
Tmem131l C A 3: 83,910,419 C1257F probably damaging Het
Tmem136 C A 9: 43,111,513 C182F probably damaging Het
Ttn A G 2: 76,969,249 V429A possibly damaging Het
Umodl1 A G 17: 31,002,863 T1280A probably benign Het
Xpnpep3 A G 15: 81,451,029 probably benign Het
Other mutations in Klk14
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0309:Klk14 UTSW 7 43694345 missense probably benign 0.01
R0467:Klk14 UTSW 7 43694110 missense probably benign 0.33
R1432:Klk14 UTSW 7 43694918 missense probably damaging 1.00
R1575:Klk14 UTSW 7 43693953 critical splice acceptor site probably null
R2160:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R2185:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R2188:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R2189:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R2472:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R2474:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R2961:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R2962:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R2968:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R3147:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R3148:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R3176:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R3177:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R3276:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R3277:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R3418:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R3419:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R3430:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4080:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4081:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4152:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4153:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4169:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4205:Klk14 UTSW 7 43694934 missense probably benign 0.00
R4284:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4285:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4287:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4356:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4359:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4379:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4380:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4381:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4611:Klk14 UTSW 7 43694357 missense probably damaging 1.00
R4684:Klk14 UTSW 7 43691968 missense probably benign
R4784:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4792:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4793:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4825:Klk14 UTSW 7 43692076 missense probably damaging 1.00
R4844:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4847:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4884:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4898:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4941:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4942:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4943:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4972:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R4997:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R5021:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R5022:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R5024:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R5053:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R5054:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R5056:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R5057:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R5097:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R5253:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R5257:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R5459:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R5489:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R5490:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R5493:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R5543:Klk14 UTSW 7 43692077 missense probably damaging 1.00
R6823:Klk14 UTSW 7 43694456 nonsense probably null
R7960:Klk14 UTSW 7 43692043 missense probably damaging 1.00
R7993:Klk14 UTSW 7 43694943 missense probably benign 0.01
R8220:Klk14 UTSW 7 43694074 missense probably damaging 1.00
X0064:Klk14 UTSW 7 43694110 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- AAAGATCTCTGTCTGCTGGGC -3'
(R):5'- GGCAAGGGTTCTACATACACTCTG -3'

Sequencing Primer
(F):5'- ATCTCTGTCTGCTGGGCATTGG -3'
(R):5'- TGAATTATGCCTCTCAGCCTAG -3'
Posted On2015-04-29