Incidental Mutation 'R3956:Acsl1'
ID310699
Institutional Source Beutler Lab
Gene Symbol Acsl1
Ensembl Gene ENSMUSG00000018796
Gene Nameacyl-CoA synthetase long-chain family member 1
SynonymsFacl2, Acas1
MMRRC Submission 040833-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.302) question?
Stock #R3956 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location46471037-46536051 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 46534458 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 693 (L693Q)
Ref Sequence ENSEMBL: ENSMUSP00000106001 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034046] [ENSMUST00000110371] [ENSMUST00000110372]
Predicted Effect probably damaging
Transcript: ENSMUST00000034046
AA Change: L693Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034046
Gene: ENSMUSG00000018796
AA Change: L693Q

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
low complexity region 76 90 N/A INTRINSIC
Pfam:AMP-binding 97 564 7.9e-113 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110371
AA Change: L693Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106000
Gene: ENSMUSG00000018796
AA Change: L693Q

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
low complexity region 76 90 N/A INTRINSIC
Pfam:AMP-binding 97 564 4.1e-111 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110372
AA Change: L693Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106001
Gene: ENSMUSG00000018796
AA Change: L693Q

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
low complexity region 76 90 N/A INTRINSIC
Pfam:AMP-binding 101 564 9.7e-104 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152423
SMART Domains Protein: ENSMUSP00000118845
Gene: ENSMUSG00000018796

DomainStartEndE-ValueType
SCOP:d1lci__ 2 65 2e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210929
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.5%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to a family of acyl coenzyme A synthetase proteins, which convert long chain fatty acids to acyl CoA products via an ATP-dependent pathway. This enzyme is enriched in heart, liver and adipose tissue, where it functions in lipid synthesis and mitochondrial and peroxisomal beta-oxidation. In addition, it is expressed in monocytes and macrophages where it appears to have a functionally distinct role in mediating inflammatory and innate immune responses. A pseudogene of this gene is found on chromosome 5. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Liver acyl-CoA levels are reduced when this gene is conditionally knocked out in the liver. Impaired adaptive thermogenesis when this gene is conditionally knocked out in adipose tissue. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik A G 13: 58,384,389 S118P probably damaging Het
9330159F19Rik A G 10: 29,224,809 K393E possibly damaging Het
Aagab A G 9: 63,619,160 E155G probably damaging Het
Abca16 A G 7: 120,527,752 N1221S probably damaging Het
Acad11 A G 9: 104,086,152 probably benign Het
Adam2 G A 14: 66,057,610 S262L probably damaging Het
B3gat1 A G 9: 26,757,028 T305A possibly damaging Het
BC051076 A G 5: 87,964,251 noncoding transcript Het
Ccni A G 5: 93,183,404 L236S probably damaging Het
Cdc45 A G 16: 18,805,430 V119A probably benign Het
Clspn ACGGCGGCGGC A 4: 126,566,437 probably null Het
Creld1 A G 6: 113,492,229 D340G possibly damaging Het
Dnah2 T A 11: 69,484,021 I1417L probably benign Het
Efhc1 A C 1: 20,978,666 K434N probably damaging Het
Evi5l T C 8: 4,191,358 V297A possibly damaging Het
Fam49b T C 15: 63,941,974 Y158C probably damaging Het
Fam58b C A 11: 78,751,023 E214* probably null Het
Fam69b C T 2: 26,635,567 P171L probably benign Het
Fkbp8 T G 8: 70,534,867 S376A probably damaging Het
Gfod1 A T 13: 43,201,062 C146S probably damaging Het
Gm8882 G T 6: 132,361,851 Q135K unknown Het
Gm960 T A 19: 4,692,497 T214S probably benign Het
Greb1 G T 12: 16,682,299 P1554T probably damaging Het
Grip1 A T 10: 119,930,026 I88F probably damaging Het
Hbq1a T C 11: 32,300,214 probably null Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Kmt2e A G 5: 23,496,025 T121A probably benign Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Mfsd2b A T 12: 4,866,848 F194Y probably damaging Het
Mtmr3 A T 11: 4,491,138 V504E probably damaging Het
Neb C T 2: 52,201,963 V5030M possibly damaging Het
Nup210l A T 3: 90,193,054 R1462S possibly damaging Het
Olfr1039 C T 2: 86,131,019 V215I probably benign Het
Olfr1042 A G 2: 86,159,938 V144A probably benign Het
Olfr199 G A 16: 59,216,065 Q183* probably null Het
Pmfbp1 A G 8: 109,530,169 S502G probably benign Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Ralgapa2 C T 2: 146,435,964 V426I probably damaging Het
Rasgrf2 A G 13: 91,982,855 S696P probably damaging Het
Riok3 T A 18: 12,142,974 Y242* probably null Het
Robo2 T G 16: 73,961,867 Y672S probably damaging Het
Rsbn1 A G 3: 103,928,675 H343R probably damaging Het
Sar1a A T 10: 61,686,393 N88I possibly damaging Het
Sgcz A G 8: 37,526,192 probably benign Het
Tbc1d9 C T 8: 83,233,532 T138I probably damaging Het
Tex37 A G 6: 70,913,485 Y108H possibly damaging Het
Tmem131l C A 3: 83,910,419 C1257F probably damaging Het
Tmem136 C A 9: 43,111,513 C182F probably damaging Het
Ttn A G 2: 76,969,249 V429A possibly damaging Het
Umodl1 A G 17: 31,002,863 T1280A probably benign Het
Xpnpep3 A G 15: 81,451,029 probably benign Het
Other mutations in Acsl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00529:Acsl1 APN 8 46513760 unclassified probably benign
IGL01356:Acsl1 APN 8 46511463 critical splice donor site probably null
IGL02227:Acsl1 APN 8 46534365 missense probably benign 0.40
IGL02812:Acsl1 APN 8 46492836 missense possibly damaging 0.47
IGL03061:Acsl1 APN 8 46508337 missense probably damaging 0.97
IGL03329:Acsl1 APN 8 46492994 missense possibly damaging 0.88
R0019:Acsl1 UTSW 8 46521250 intron probably null
R0190:Acsl1 UTSW 8 46513392 critical splice donor site probably null
R0233:Acsl1 UTSW 8 46513569 unclassified probably benign
R0479:Acsl1 UTSW 8 46531072 missense probably damaging 1.00
R1325:Acsl1 UTSW 8 46513300 missense probably benign
R1930:Acsl1 UTSW 8 46530986 missense probably benign 0.21
R1931:Acsl1 UTSW 8 46530986 missense probably benign 0.21
R2035:Acsl1 UTSW 8 46528584 missense probably damaging 1.00
R2126:Acsl1 UTSW 8 46533626 missense probably benign 0.01
R2167:Acsl1 UTSW 8 46533590 missense possibly damaging 0.91
R3051:Acsl1 UTSW 8 46521337 missense probably benign 0.00
R3052:Acsl1 UTSW 8 46521337 missense probably benign 0.00
R3753:Acsl1 UTSW 8 46513565 unclassified probably benign
R3883:Acsl1 UTSW 8 46527191 missense probably benign 0.19
R4622:Acsl1 UTSW 8 46526373 missense probably benign 0.02
R5012:Acsl1 UTSW 8 46521431 missense probably benign 0.01
R5168:Acsl1 UTSW 8 46513266 unclassified probably benign
R5464:Acsl1 UTSW 8 46505738 missense probably benign
R5678:Acsl1 UTSW 8 46492850 missense probably benign 0.03
R7151:Acsl1 UTSW 8 46513597 missense probably damaging 1.00
R7831:Acsl1 UTSW 8 46519006 missense probably benign 0.01
R7914:Acsl1 UTSW 8 46519006 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCGCCTTAAAGGTTGTCATCTC -3'
(R):5'- ATCCCTATGGTAAGACCCCG -3'

Sequencing Primer
(F):5'- AGACAACGTCTGTGTGTCTGACC -3'
(R):5'- TATGGTAAGACCCCGTGGAC -3'
Posted On2015-04-29