Mutagenetix > Incidental Mutations

Incidental Mutation 'R3956:Grip1'

310709

Institutional Source

Beutler Lab

Gene Symbol

Grip1

Ensembl Gene

ENSMUSG00000034813

Gene Name

glutamate receptor interacting protein 1

Synonyms

MMRRC Submission

040833-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R3956 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

119453830-120087261 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 119930026 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 88 (I88F)

Ref Sequence

ENSEMBL: ENSMUSP00000122323 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041962] [ENSMUST00000077871] [ENSMUST00000105262] [ENSMUST00000138410] [ENSMUST00000144825] [ENSMUST00000144959] [ENSMUST00000147356] [ENSMUST00000147454] [ENSMUST00000148954]

Predicted Effect

probably damaging
Transcript: ENSMUST00000041962
AA Change: I89F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000042436
Gene: ENSMUSG00000034813
AA Change: I89F

Domain	Start	End	E-Value	Type
PDZ	63	137	4.86e-13	SMART
PDZ	161	239	6.4e-22	SMART
PDZ	262	337	1.97e-13	SMART
low complexity region	354	367	N/A	INTRINSIC
low complexity region	388	405	N/A	INTRINSIC
low complexity region	413	424	N/A	INTRINSIC
PDZ	429	509	6.36e-17	SMART
PDZ	530	606	1.11e-16	SMART
PDZ	629	703	1.73e-18	SMART
PDZ	947	1019	2.79e-13	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000077871
AA Change: I62F

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000077033
Gene: ENSMUSG00000034813
AA Change: I62F

Domain	Start	End	E-Value	Type
PDZ	36	110	4.86e-13	SMART
PDZ	134	212	6.4e-22	SMART
PDZ	235	310	1.97e-13	SMART
low complexity region	327	340	N/A	INTRINSIC
low complexity region	361	378	N/A	INTRINSIC
low complexity region	386	397	N/A	INTRINSIC
PDZ	402	482	6.36e-17	SMART
PDZ	503	579	1.11e-16	SMART
PDZ	602	676	1.73e-18	SMART
PDZ	920	992	2.79e-13	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000105262
AA Change: I88F

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000100897
Gene: ENSMUSG00000034813
AA Change: I88F

Domain	Start	End	E-Value	Type
PDZ	62	136	4.86e-13	SMART
PDZ	160	238	6.4e-22	SMART
PDZ	261	336	1.97e-13	SMART
low complexity region	353	366	N/A	INTRINSIC
low complexity region	387	404	N/A	INTRINSIC
low complexity region	412	423	N/A	INTRINSIC
PDZ	428	508	6.36e-17	SMART
PDZ	529	605	1.11e-16	SMART
PDZ	628	702	1.73e-18	SMART
PDZ	946	1018	2.79e-13	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127787

Predicted Effect

probably damaging
Transcript: ENSMUST00000138410
AA Change: I88F

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000123234
Gene: ENSMUSG00000034813
AA Change: I88F

Domain	Start	End	E-Value	Type
PDZ	62	136	4.86e-13	SMART
PDZ	160	238	6.4e-22	SMART
PDZ	261	336	1.97e-13	SMART
low complexity region	393	421	N/A	INTRINSIC
low complexity region	439	456	N/A	INTRINSIC
low complexity region	464	475	N/A	INTRINSIC
PDZ	480	560	6.36e-17	SMART
PDZ	581	657	1.11e-16	SMART
PDZ	680	754	1.73e-18	SMART
PDZ	1013	1085	2.79e-13	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139352

Predicted Effect

probably benign
Transcript: ENSMUST00000144825
AA Change: I61F

PolyPhen 2 Score 0.329 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000121670
Gene: ENSMUSG00000034813
AA Change: I61F

Domain	Start	End	E-Value	Type
PDZ	35	109	4.86e-13	SMART
PDZ	133	211	6.4e-22	SMART
PDZ	234	309	1.97e-13	SMART
low complexity region	326	339	N/A	INTRINSIC
low complexity region	360	377	N/A	INTRINSIC
low complexity region	385	396	N/A	INTRINSIC
PDZ	401	481	6.36e-17	SMART
PDZ	502	578	1.11e-16	SMART
PDZ	601	675	1.73e-18	SMART
PDZ	919	991	2.79e-13	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000144959
AA Change: I88F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000122323
Gene: ENSMUSG00000034813
AA Change: I88F

Domain	Start	End	E-Value	Type
PDZ	62	136	4.86e-13	SMART
PDZ	160	238	6.4e-22	SMART
PDZ	261	336	1.97e-13	SMART
low complexity region	393	421	N/A	INTRINSIC
low complexity region	439	456	N/A	INTRINSIC
low complexity region	464	475	N/A	INTRINSIC
PDZ	480	560	6.36e-17	SMART
PDZ	581	657	1.11e-16	SMART
PDZ	680	754	1.73e-18	SMART
PDZ	998	1070	2.79e-13	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000147356
AA Change: I89F

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000115478
Gene: ENSMUSG00000034813
AA Change: I89F

Domain	Start	End	E-Value	Type
PDZ	63	137	4.86e-13	SMART
PDZ	161	239	6.4e-22	SMART
PDZ	262	337	1.97e-13	SMART
low complexity region	394	422	N/A	INTRINSIC
low complexity region	440	457	N/A	INTRINSIC
low complexity region	465	476	N/A	INTRINSIC
PDZ	481	561	6.36e-17	SMART
PDZ	582	658	1.11e-16	SMART
PDZ	681	755	1.73e-18	SMART
PDZ	999	1071	2.79e-13	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000147454
AA Change: I88F

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000118073
Gene: ENSMUSG00000034813
AA Change: I88F

Domain	Start	End	E-Value	Type
PDZ	62	136	4.86e-13	SMART
PDZ	160	238	6.4e-22	SMART
PDZ	261	336	1.97e-13	SMART
low complexity region	393	421	N/A	INTRINSIC
low complexity region	439	456	N/A	INTRINSIC
low complexity region	464	475	N/A	INTRINSIC
PDZ	480	560	6.36e-17	SMART
PDZ	581	657	1.11e-16	SMART
PDZ	680	754	1.73e-18	SMART
PDZ	998	1070	2.79e-13	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147598

Predicted Effect

possibly damaging
Transcript: ENSMUST00000148954
AA Change: I88F

PolyPhen 2 Score 0.730 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000118397
Gene: ENSMUSG00000034813
AA Change: I88F

Domain	Start	End	E-Value	Type
PDZ	62	136	4.86e-13	SMART
PDZ	160	238	6.4e-22	SMART
PDZ	261	336	1.97e-13	SMART
low complexity region	353	366	N/A	INTRINSIC
low complexity region	387	404	N/A	INTRINSIC
low complexity region	412	423	N/A	INTRINSIC
PDZ	428	508	6.36e-17	SMART
PDZ	529	605	1.11e-16	SMART
PDZ	628	702	1.73e-18	SMART
PDZ	961	1033	2.79e-13	SMART

Meta Mutation Damage Score

0.1022

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 93.5%

Validation Efficiency

100% (56/56)

MGI Phenotype

FUNCTION: This gene encodes a protein containing multiple PDZ (post synaptic density protein, Drosophila disc large tumor suppressor, and zonula occludens-1 protein) domains. The encoded protein acts as a mediator between cytoskeletal and membrane proteins, particularly in neuronal cells, and facilitates complex formation at the cell membrane. Mutation of this gene can cause embryonic lethality resulting from defects of the dermo-epidermal junction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Homozygous ablation of gene function results in embryonic lethality and blistering skin lesions. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210016F16Rik	A	G	13: 58,384,389	S118P	probably damaging	Het
9330159F19Rik	A	G	10: 29,224,809	K393E	possibly damaging	Het
Aagab	A	G	9: 63,619,160	E155G	probably damaging	Het
Abca16	A	G	7: 120,527,752	N1221S	probably damaging	Het
Acad11	A	G	9: 104,086,152		probably benign	Het
Acsl1	T	A	8: 46,534,458	L693Q	probably damaging	Het
Adam2	G	A	14: 66,057,610	S262L	probably damaging	Het
B3gat1	A	G	9: 26,757,028	T305A	possibly damaging	Het
BC051076	A	G	5: 87,964,251		noncoding transcript	Het
Ccni	A	G	5: 93,183,404	L236S	probably damaging	Het
Cdc45	A	G	16: 18,805,430	V119A	probably benign	Het
Clspn	ACGGCGGCGGC	A	4: 126,566,437		probably null	Het
Creld1	A	G	6: 113,492,229	D340G	possibly damaging	Het
Dnah2	T	A	11: 69,484,021	I1417L	probably benign	Het
Efhc1	A	C	1: 20,978,666	K434N	probably damaging	Het
Evi5l	T	C	8: 4,191,358	V297A	possibly damaging	Het
Fam49b	T	C	15: 63,941,974	Y158C	probably damaging	Het
Fam58b	C	A	11: 78,751,023	E214*	probably null	Het
Fam69b	C	T	2: 26,635,567	P171L	probably benign	Het
Fkbp8	T	G	8: 70,534,867	S376A	probably damaging	Het
Gfod1	A	T	13: 43,201,062	C146S	probably damaging	Het
Gm8882	G	T	6: 132,361,851	Q135K	unknown	Het
Gm960	T	A	19: 4,692,497	T214S	probably benign	Het
Greb1	G	T	12: 16,682,299	P1554T	probably damaging	Het
Hbq1a	T	C	11: 32,300,214		probably null	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Kmt2e	A	G	5: 23,496,025	T121A	probably benign	Het
Lmf1	G	A	17: 25,654,471	V317M	probably damaging	Het
Mfsd2b	A	T	12: 4,866,848	F194Y	probably damaging	Het
Mtmr3	A	T	11: 4,491,138	V504E	probably damaging	Het
Neb	C	T	2: 52,201,963	V5030M	possibly damaging	Het
Nup210l	A	T	3: 90,193,054	R1462S	possibly damaging	Het
Olfr1039	C	T	2: 86,131,019	V215I	probably benign	Het
Olfr1042	A	G	2: 86,159,938	V144A	probably benign	Het
Olfr199	G	A	16: 59,216,065	Q183*	probably null	Het
Pmfbp1	A	G	8: 109,530,169	S502G	probably benign	Het
Ptgir	A	G	7: 16,906,869	M29V	possibly damaging	Het
Ralgapa2	C	T	2: 146,435,964	V426I	probably damaging	Het
Rasgrf2	A	G	13: 91,982,855	S696P	probably damaging	Het
Riok3	T	A	18: 12,142,974	Y242*	probably null	Het
Robo2	T	G	16: 73,961,867	Y672S	probably damaging	Het
Rsbn1	A	G	3: 103,928,675	H343R	probably damaging	Het
Sar1a	A	T	10: 61,686,393	N88I	possibly damaging	Het
Sgcz	A	G	8: 37,526,192		probably benign	Het
Tbc1d9	C	T	8: 83,233,532	T138I	probably damaging	Het
Tex37	A	G	6: 70,913,485	Y108H	possibly damaging	Het
Tmem131l	C	A	3: 83,910,419	C1257F	probably damaging	Het
Tmem136	C	A	9: 43,111,513	C182F	probably damaging	Het
Ttn	A	G	2: 76,969,249	V429A	possibly damaging	Het
Umodl1	A	G	17: 31,002,863	T1280A	probably benign	Het
Xpnpep3	A	G	15: 81,451,029		probably benign	Het

Other mutations in Grip1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01309:Grip1	APN	10	119931302	nonsense	probably null
IGL01374:Grip1	APN	10	120049368	missense	probably benign	0.03
IGL01592:Grip1	APN	10	119930003	missense	probably damaging	1.00
IGL02207:Grip1	APN	10	120075309	missense	probably damaging	1.00
IGL02222:Grip1	APN	10	119999809	missense	probably damaging	1.00
IGL02225:Grip1	APN	10	120049453	missense	probably damaging	1.00
IGL02447:Grip1	APN	10	120020071	missense	probably damaging	1.00
IGL02492:Grip1	APN	10	119930040	splice site	probably benign
IGL02522:Grip1	APN	10	119931249	missense	probably damaging	1.00
IGL02574:Grip1	APN	10	119942913	missense	probably damaging	1.00
IGL02718:Grip1	APN	10	120075515	makesense	probably null
IGL02751:Grip1	APN	10	119978577	missense	probably benign	0.08
IGL03221:Grip1	APN	10	119986394	missense	probably benign	0.00
IGL03377:Grip1	APN	10	120055032	missense	probably damaging	0.98
PIT4403001:Grip1	UTSW	10	119929928	missense	probably damaging	1.00
R0304:Grip1	UTSW	10	120075471	missense	probably benign	0.31
R0681:Grip1	UTSW	10	120010230	missense	probably damaging	1.00
R0760:Grip1	UTSW	10	120018078	missense	probably damaging	0.96
R1457:Grip1	UTSW	10	119986350	missense	possibly damaging	0.73
R1506:Grip1	UTSW	10	119978451	missense	probably damaging	1.00
R1541:Grip1	UTSW	10	120000543	missense	probably damaging	0.99
R1553:Grip1	UTSW	10	120054851	missense	probably damaging	1.00
R1709:Grip1	UTSW	10	119897715	missense	probably damaging	0.98
R2055:Grip1	UTSW	10	120049511	splice site	probably benign
R2059:Grip1	UTSW	10	120038698	missense	possibly damaging	0.80
R2261:Grip1	UTSW	10	119985584	missense	probably benign	0.00
R2475:Grip1	UTSW	10	119978496	missense	probably benign	0.01
R3777:Grip1	UTSW	10	119985630	critical splice donor site	probably null
R3849:Grip1	UTSW	10	119929958	missense	probably damaging	1.00
R4643:Grip1	UTSW	10	120020101	missense	probably damaging	1.00
R4693:Grip1	UTSW	10	120000554	missense	probably benign	0.10
R4724:Grip1	UTSW	10	120038683	missense	probably benign	0.02
R4843:Grip1	UTSW	10	119930015	missense	probably damaging	1.00
R4884:Grip1	UTSW	10	120075306	missense	probably damaging	1.00
R4912:Grip1	UTSW	10	119931248	missense	probably damaging	1.00
R5185:Grip1	UTSW	10	119931259	missense	probably benign	0.37
R5291:Grip1	UTSW	10	120086969	missense	probably benign	0.04
R5293:Grip1	UTSW	10	119897735	missense	probably damaging	0.99
R5296:Grip1	UTSW	10	119929928	missense	probably damaging	1.00
R5302:Grip1	UTSW	10	120020077	missense	probably damaging	1.00
R5541:Grip1	UTSW	10	120072718	missense	probably damaging	1.00
R5792:Grip1	UTSW	10	119985480	missense	probably benign	0.07
R5861:Grip1	UTSW	10	119929970	missense	probably damaging	1.00
R5905:Grip1	UTSW	10	119985492	missense	probably benign	0.02
R5949:Grip1	UTSW	10	120050242	missense	probably benign	0.00
R6112:Grip1	UTSW	10	119993232	missense	probably benign	0.00
R6166:Grip1	UTSW	10	120072718	missense	probably damaging	1.00
R6167:Grip1	UTSW	10	119897797	critical splice donor site	probably null
R6193:Grip1	UTSW	10	120038314	missense	probably damaging	1.00
R6218:Grip1	UTSW	10	119986346	missense	possibly damaging	0.95
R6267:Grip1	UTSW	10	120075464	nonsense	probably null
R6296:Grip1	UTSW	10	120075464	nonsense	probably null
R6490:Grip1	UTSW	10	119986424	missense	possibly damaging	0.82
R6543:Grip1	UTSW	10	119985594	missense	probably benign	0.00
R6558:Grip1	UTSW	10	119454383	missense	probably benign	0.00
R6995:Grip1	UTSW	10	119986470	missense	probably damaging	0.99
R7122:Grip1	UTSW	10	120035374	missense	possibly damaging	0.48
R7157:Grip1	UTSW	10	119945156	missense	probably damaging	1.00
R7410:Grip1	UTSW	10	120020020	missense	probably benign	0.01
R7447:Grip1	UTSW	10	120086966	missense	probably benign	0.01
R7539:Grip1	UTSW	10	120054871	missense	probably benign	0.17
R7586:Grip1	UTSW	10	120077138	splice site	probably null
R7768:Grip1	UTSW	10	120038397	missense	probably damaging	0.98
R7831:Grip1	UTSW	10	120018106	missense	probably damaging	1.00
R7896:Grip1	UTSW	10	119978545	missense	possibly damaging	0.53
R8103:Grip1	UTSW	10	119978535	missense	probably benign	0.00
R8254:Grip1	UTSW	10	120054905	nonsense	probably null
RF011:Grip1	UTSW	10	119931315	missense	probably null	0.97
Z1176:Grip1	UTSW	10	119819483	unclassified	probably benign
Z1177:Grip1	UTSW	10	119986444	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- GACTGCCTCTCGTTTAATGGG -3'
(R):5'- AGGTGACACAAACGTCCTCAG -3'

Sequencing Primer
(F):5'- GCCTCTCGTTTAATGGGCTAAATGC -3'
(R):5'- GTGACCTTTTCTGATAAGCTC -3'

Posted On

2015-04-29