Incidental Mutation 'R3957:Olfr127'
ID310785
Institutional Source Beutler Lab
Gene Symbol Olfr127
Ensembl Gene ENSMUSG00000058114
Gene Nameolfactory receptor 127
SynonymsMOR218-7, GA_x6K02T2PSCP-2354126-2355093
MMRRC Submission 040931-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R3957 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location37900437-37906795 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37903609 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 21 (H21L)
Ref Sequence ENSEMBL: ENSMUSP00000149133 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076331] [ENSMUST00000217223]
Predicted Effect probably benign
Transcript: ENSMUST00000076331
AA Change: H21L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000075669
Gene: ENSMUSG00000058114
AA Change: H21L

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3.7e-46 PFAM
Pfam:7tm_1 41 290 1.4e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217223
AA Change: H21L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik A G 10: 29,224,809 K393E possibly damaging Het
Acsm4 A T 7: 119,703,365 M238L possibly damaging Het
Adam2 G A 14: 66,057,610 S262L probably damaging Het
Atp13a5 T A 16: 29,298,194 I579L probably benign Het
Canx A G 11: 50,308,383 V153A probably damaging Het
Cdan1 A G 2: 120,725,632 Y718H probably damaging Het
Cdan1 G A 2: 120,731,020 probably benign Het
Cpsf3 A G 12: 21,313,805 D632G probably benign Het
Dach1 T C 14: 97,840,109 T561A probably damaging Het
Dennd5a A G 7: 109,905,699 M868T probably benign Het
Dhx29 C T 13: 112,930,921 A112V probably benign Het
Fanca G A 8: 123,316,363 R95C probably benign Het
Fat4 C A 3: 38,982,346 N3382K probably benign Het
Fkbp15 A C 4: 62,334,252 F290L probably benign Het
Fkbp8 T G 8: 70,534,867 S376A probably damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Igfn1 A G 1: 135,967,180 Y1883H possibly damaging Het
Ighv3-4 T A 12: 114,253,680 Q97L probably damaging Het
Igkv15-103 A T 6: 68,437,919 Y114F probably benign Het
Kera G A 10: 97,612,845 R309H probably benign Het
Kif1a T A 1: 93,025,694 H1256L probably damaging Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Lmx1b T C 2: 33,569,094 E149G probably damaging Het
Me2 A G 18: 73,781,132 F443L probably damaging Het
Med12l T A 3: 59,073,168 S307R probably damaging Het
Mocs2 T A 13: 114,825,267 probably null Het
Nek7 C A 1: 138,534,389 C79F probably damaging Het
Olfr1042 A G 2: 86,159,938 V144A probably benign Het
Olfr1173 A G 2: 88,275,004 F15S probably damaging Het
Olfr566 A G 7: 102,856,617 C222R probably damaging Het
Ovch2 G A 7: 107,789,111 L421F probably damaging Het
Pan2 C T 10: 128,315,177 R806C probably damaging Het
Plod3 A T 5: 136,994,192 H616L probably damaging Het
Plxnb3 T C X: 73,771,220 V1789A probably benign Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Rrnad1 T C 3: 87,926,828 K116R possibly damaging Het
Tbc1d9 C T 8: 83,233,532 T138I probably damaging Het
Tdrkh A G 3: 94,428,249 N383S probably damaging Het
Trim30d C T 7: 104,472,521 G339D probably damaging Het
Trub1 G A 19: 57,485,366 A239T possibly damaging Het
Tspan32 T A 7: 143,006,998 M61K probably damaging Het
Ttc6 T C 12: 57,697,452 V1290A probably benign Het
Ttn A G 2: 76,969,249 V429A possibly damaging Het
Unc13b A G 4: 43,256,834 Y3962C probably damaging Het
Usp3 T C 9: 66,562,591 T83A probably benign Het
Vmn2r95 T A 17: 18,440,096 Y257N possibly damaging Het
Zmym6 T C 4: 127,123,296 S957P possibly damaging Het
Zmynd8 T C 2: 165,812,475 T722A probably damaging Het
Other mutations in Olfr127
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00901:Olfr127 APN 17 37904257 missense probably damaging 0.98
IGL00981:Olfr127 APN 17 37904181 missense probably benign 0.03
IGL02271:Olfr127 APN 17 37904243 missense probably benign 0.22
IGL02409:Olfr127 APN 17 37903788 missense probably damaging 0.99
R1649:Olfr127 UTSW 17 37904169 missense probably benign 0.09
R1808:Olfr127 UTSW 17 37903770 missense probably damaging 1.00
R2360:Olfr127 UTSW 17 37904454 missense possibly damaging 0.94
R3808:Olfr127 UTSW 17 37903573 missense probably benign 0.00
R3809:Olfr127 UTSW 17 37903573 missense probably benign 0.00
R3953:Olfr127 UTSW 17 37903609 missense probably benign 0.00
R3955:Olfr127 UTSW 17 37903609 missense probably benign 0.00
R4683:Olfr127 UTSW 17 37904148 missense probably benign
R5430:Olfr127 UTSW 17 37904413 missense probably damaging 1.00
R5716:Olfr127 UTSW 17 37903828 missense probably benign 0.00
R5866:Olfr127 UTSW 17 37903809 nonsense probably null
R7074:Olfr127 UTSW 17 37903827 missense possibly damaging 0.80
R7238:Olfr127 UTSW 17 37904437 missense probably benign 0.37
R8098:Olfr127 UTSW 17 37904359 missense probably damaging 1.00
R8212:Olfr127 UTSW 17 37904257 missense probably benign 0.00
R8559:Olfr127 UTSW 17 37903828 missense probably benign 0.00
R8865:Olfr127 UTSW 17 37904224 missense probably damaging 1.00
X0021:Olfr127 UTSW 17 37903756 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCTTGATAAACTGCAATTCC -3'
(R):5'- CATACTGGGGAACTGTGACAG -3'

Sequencing Primer
(F):5'- GCTTGATAAACTGCAATTCCTTAAAC -3'
(R):5'- CTGTGACAGAGAGAGATGAGAAGTCC -3'
Posted On2015-04-29