Incidental Mutation 'R3958:Olfr1287'
ID310794
Institutional Source Beutler Lab
Gene Symbol Olfr1287
Ensembl Gene ENSMUSG00000095586
Gene Nameolfactory receptor 1287
SynonymsMOR248-15, GA_x6K02T2Q125-72500603-72501520
MMRRC Submission 040834-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R3958 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location111449142-111450059 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 111449885 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 248 (L248F)
Ref Sequence ENSEMBL: ENSMUSP00000074850 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075390]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075390
AA Change: L248F

PolyPhen 2 Score 0.495 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000074850
Gene: ENSMUSG00000095586
AA Change: L248F

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 6.7e-48 PFAM
Pfam:7tm_1 41 287 9.5e-20 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl9 A G 17: 33,433,764 K266R probably benign Het
Cebpd T C 16: 15,887,463 S47P possibly damaging Het
Celf4 A G 18: 25,537,754 M124T probably benign Het
Ckap4 C T 10: 84,528,164 R345H probably benign Het
Clasp1 T C 1: 118,467,881 V183A probably damaging Het
Cyp2s1 C T 7: 25,803,954 R424Q probably null Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Etl4 A G 2: 20,340,043 T53A probably benign Het
Glyat A T 19: 12,639,833 K16N probably benign Het
Gm6522 T C 3: 106,298,804 noncoding transcript Het
Grin1 G A 2: 25,313,453 T182M probably damaging Het
Hcn4 T C 9: 58,844,048 V319A unknown Het
Hmgcs2 T C 3: 98,297,477 F317S possibly damaging Het
Hoxd8 C T 2: 74,706,540 Q18* probably null Het
Itpr2 C T 6: 146,425,510 V120I probably damaging Het
Kmt2d G A 15: 98,855,549 T141M possibly damaging Het
Lrp1 A G 10: 127,571,958 S1821P probably benign Het
Neb T C 2: 52,263,629 E2428G probably damaging Het
Nepn T C 10: 52,400,708 V119A probably benign Het
Otogl T C 10: 107,821,925 D1048G probably damaging Het
Panx1 GTTCTTCT GTTCT 9: 15,006,171 probably benign Het
Ppp6r3 A T 19: 3,496,583 V305D probably damaging Het
Prkg2 G T 5: 98,997,495 T160K possibly damaging Het
Prmt8 G A 6: 127,732,744 T51I probably benign Het
Rgl3 T C 9: 21,975,589 probably benign Het
Sec23ip C G 7: 128,776,850 T796S probably benign Het
Selp T C 1: 164,126,286 S52P probably benign Het
Slc44a2 T C 9: 21,348,541 I615T probably damaging Het
Snap91 T C 9: 86,838,130 Y118C probably damaging Het
Tmem106b A T 6: 13,081,588 N165Y probably damaging Het
Ucp3 A G 7: 100,482,739 T266A probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Utrn T C 10: 12,750,108 I110V probably damaging Het
Other mutations in Olfr1287
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01655:Olfr1287 APN 2 111449889 missense probably benign 0.13
IGL01748:Olfr1287 APN 2 111449530 missense probably damaging 1.00
IGL02264:Olfr1287 APN 2 111449862 missense probably benign 0.05
IGL02371:Olfr1287 APN 2 111450009 missense probably damaging 1.00
IGL02385:Olfr1287 APN 2 111449350 missense probably damaging 1.00
IGL02704:Olfr1287 APN 2 111449147 missense probably benign 0.00
R0368:Olfr1287 UTSW 2 111449788 missense probably benign 0.07
R1520:Olfr1287 UTSW 2 111449274 missense probably benign 0.00
R2036:Olfr1287 UTSW 2 111449626 missense possibly damaging 0.80
R2890:Olfr1287 UTSW 2 111449289 missense probably benign 0.12
R3757:Olfr1287 UTSW 2 111449257 missense possibly damaging 0.95
R3801:Olfr1287 UTSW 2 111449565 missense probably benign 0.07
R4077:Olfr1287 UTSW 2 111449503 missense probably damaging 0.99
R4763:Olfr1287 UTSW 2 111449678 nonsense probably null
R4955:Olfr1287 UTSW 2 111449605 missense probably damaging 1.00
R4975:Olfr1287 UTSW 2 111449683 missense probably benign 0.16
R5046:Olfr1287 UTSW 2 111449589 missense probably benign 0.01
R5512:Olfr1287 UTSW 2 111449754 missense probably benign 0.00
R5708:Olfr1287 UTSW 2 111450009 missense probably damaging 1.00
R5771:Olfr1287 UTSW 2 111450061 unclassified probably null
R5780:Olfr1287 UTSW 2 111449833 missense probably benign 0.03
R6981:Olfr1287 UTSW 2 111449352 missense probably benign 0.00
R7073:Olfr1287 UTSW 2 111449286 missense probably benign 0.22
R7633:Olfr1287 UTSW 2 111449622 missense probably benign
RF037:Olfr1287 UTSW 2 111449551 missense not run
RF039:Olfr1287 UTSW 2 111449551 missense not run
Z1088:Olfr1287 UTSW 2 111449457 missense probably benign 0.02
Z1176:Olfr1287 UTSW 2 111449784 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGGACCTAGAGTGATAGACAGC -3'
(R):5'- CAGAATTCACAAGTGGTTTATCAGC -3'

Sequencing Primer
(F):5'- GCCTGCATGAATACTGATACTCTGG -3'
(R):5'- AAGTGGTTTATCAGCTTCTTTATGGC -3'
Posted On2015-04-29