Incidental Mutation 'R3958:Hmgcs2'
ID310795
Institutional Source Beutler Lab
Gene Symbol Hmgcs2
Ensembl Gene ENSMUSG00000027875
Gene Name3-hydroxy-3-methylglutaryl-Coenzyme A synthase 2
SynonymsmHS
MMRRC Submission 040834-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R3958 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location98280435-98310738 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 98297477 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 317 (F317S)
Ref Sequence ENSEMBL: ENSMUSP00000113296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090746] [ENSMUST00000120541]
Predicted Effect possibly damaging
Transcript: ENSMUST00000090746
AA Change: F317S

PolyPhen 2 Score 0.476 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000088249
Gene: ENSMUSG00000027875
AA Change: F317S

DomainStartEndE-ValueType
Pfam:HMG_CoA_synt_N 50 223 2.9e-111 PFAM
Pfam:HMG_CoA_synt_C 224 506 6.6e-131 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000120541
AA Change: F317S

PolyPhen 2 Score 0.476 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000113296
Gene: ENSMUSG00000027875
AA Change: F317S

DomainStartEndE-ValueType
Pfam:HMG_CoA_synt_N 50 223 7.2e-108 PFAM
Pfam:HMG_CoA_synt_C 224 506 1.8e-131 PFAM
Meta Mutation Damage Score 0.2440 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the HMG-CoA synthase family. It is a mitochondrial enzyme that catalyzes the first reaction of ketogenesis, a metabolic pathway that provides lipid-derived energy for various organs during times of carbohydrate deprivation, such as fasting. Mutations in this gene are associated with HMG-CoA synthase deficiency. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl9 A G 17: 33,433,764 K266R probably benign Het
Cebpd T C 16: 15,887,463 S47P possibly damaging Het
Celf4 A G 18: 25,537,754 M124T probably benign Het
Ckap4 C T 10: 84,528,164 R345H probably benign Het
Clasp1 T C 1: 118,467,881 V183A probably damaging Het
Cyp2s1 C T 7: 25,803,954 R424Q probably null Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Etl4 A G 2: 20,340,043 T53A probably benign Het
Glyat A T 19: 12,639,833 K16N probably benign Het
Gm6522 T C 3: 106,298,804 noncoding transcript Het
Grin1 G A 2: 25,313,453 T182M probably damaging Het
Hcn4 T C 9: 58,844,048 V319A unknown Het
Hoxd8 C T 2: 74,706,540 Q18* probably null Het
Itpr2 C T 6: 146,425,510 V120I probably damaging Het
Kmt2d G A 15: 98,855,549 T141M possibly damaging Het
Lrp1 A G 10: 127,571,958 S1821P probably benign Het
Neb T C 2: 52,263,629 E2428G probably damaging Het
Nepn T C 10: 52,400,708 V119A probably benign Het
Olfr1287 G T 2: 111,449,885 L248F possibly damaging Het
Otogl T C 10: 107,821,925 D1048G probably damaging Het
Panx1 GTTCTTCT GTTCT 9: 15,006,171 probably benign Het
Ppp6r3 A T 19: 3,496,583 V305D probably damaging Het
Prkg2 G T 5: 98,997,495 T160K possibly damaging Het
Prmt8 G A 6: 127,732,744 T51I probably benign Het
Rgl3 T C 9: 21,975,589 probably benign Het
Sec23ip C G 7: 128,776,850 T796S probably benign Het
Selp T C 1: 164,126,286 S52P probably benign Het
Slc44a2 T C 9: 21,348,541 I615T probably damaging Het
Snap91 T C 9: 86,838,130 Y118C probably damaging Het
Tmem106b A T 6: 13,081,588 N165Y probably damaging Het
Ucp3 A G 7: 100,482,739 T266A probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Utrn T C 10: 12,750,108 I110V probably damaging Het
Other mutations in Hmgcs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0579:Hmgcs2 UTSW 3 98290948 missense probably damaging 1.00
R0657:Hmgcs2 UTSW 3 98291053 missense probably benign
R0724:Hmgcs2 UTSW 3 98297001 nonsense probably null
R2024:Hmgcs2 UTSW 3 98299214 missense probably damaging 1.00
R2109:Hmgcs2 UTSW 3 98297021 nonsense probably null
R2202:Hmgcs2 UTSW 3 98291183 missense probably damaging 1.00
R2203:Hmgcs2 UTSW 3 98291183 missense probably damaging 1.00
R2204:Hmgcs2 UTSW 3 98291183 missense probably damaging 1.00
R2205:Hmgcs2 UTSW 3 98291183 missense probably damaging 1.00
R3758:Hmgcs2 UTSW 3 98291090 missense probably damaging 1.00
R3779:Hmgcs2 UTSW 3 98299112 splice site probably benign
R3959:Hmgcs2 UTSW 3 98297477 missense possibly damaging 0.48
R3960:Hmgcs2 UTSW 3 98297477 missense possibly damaging 0.48
R3962:Hmgcs2 UTSW 3 98291038 missense possibly damaging 0.91
R4788:Hmgcs2 UTSW 3 98291084 missense probably damaging 1.00
R5102:Hmgcs2 UTSW 3 98280470 start gained probably benign
R5708:Hmgcs2 UTSW 3 98291162 missense probably damaging 1.00
R5742:Hmgcs2 UTSW 3 98297516 missense probably benign
R7268:Hmgcs2 UTSW 3 98297480 missense probably benign 0.02
R7294:Hmgcs2 UTSW 3 98290895 missense probably benign 0.09
R7503:Hmgcs2 UTSW 3 98302624 missense probably damaging 1.00
R7767:Hmgcs2 UTSW 3 98291266 missense probably damaging 1.00
R8043:Hmgcs2 UTSW 3 98291128 missense probably damaging 1.00
Z1176:Hmgcs2 UTSW 3 98290945 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCATCTCTCTGGGAAGCTG -3'
(R):5'- TGAAAGAATGGCTTAGCATCCC -3'

Sequencing Primer
(F):5'- GAAGCTGGGCCCCTTGG -3'
(R):5'- GAAAGAATGGCTTAGCATCCCTTCTG -3'
Posted On2015-04-29