Incidental Mutation 'R3959:Evc2'
ID310830
Institutional Source Beutler Lab
Gene Symbol Evc2
Ensembl Gene ENSMUSG00000050248
Gene NameEvC ciliary complex subunit 2
SynonymsLbn, limbin
MMRRC Submission 040835-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3959 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location37338499-37425055 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 37415776 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 944 (V944E)
Ref Sequence ENSEMBL: ENSMUSP00000055130 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056365]
Predicted Effect possibly damaging
Transcript: ENSMUST00000056365
AA Change: V944E

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000055130
Gene: ENSMUSG00000050248
AA Change: V944E

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 40 59 N/A INTRINSIC
Pfam:EVC2_like 147 570 2.1e-191 PFAM
low complexity region 576 600 N/A INTRINSIC
coiled coil region 617 644 N/A INTRINSIC
low complexity region 780 791 N/A INTRINSIC
low complexity region 902 914 N/A INTRINSIC
coiled coil region 922 956 N/A INTRINSIC
low complexity region 1057 1071 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159854
Meta Mutation Damage Score 0.0911 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions in bone formation and skeletal development. Mutations in this gene, as well as in a neighboring gene that lies in a head-to-head configuration, cause Ellis-van Creveld syndrome, an autosomal recessive skeletal dysplasia that is also known as chondroectodermal dysplasia. Mutations in this gene also cause acrofacial dysostosis Weyers type, also referred to as Curry-Hall syndrome, a disease that combines limb and facial abnormalities. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit perinatal lethality, short limbs and ribs, decreased osteoblast differentiation and abnormal chondrocyte physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Adam26a T C 8: 43,569,871 H194R probably benign Het
Ccdc129 A T 6: 55,897,740 Q225L probably benign Het
Celf4 A G 18: 25,537,754 M124T probably benign Het
Csmd3 A T 15: 47,644,189 I2976K probably benign Het
Dnhd1 A G 7: 105,713,122 H3730R probably benign Het
Dock8 G A 19: 25,184,941 probably null Het
Eed C T 7: 89,954,941 R441Q probably benign Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Etl4 A G 2: 20,340,043 T53A probably benign Het
Hmgcs2 T C 3: 98,297,477 F317S possibly damaging Het
Itpr2 C T 6: 146,425,510 V120I probably damaging Het
Mapk8 A C 14: 33,382,253 M402R probably null Het
Mycbp2 T C 14: 103,295,252 Y389C probably benign Het
Nceh1 T C 3: 27,279,196 I147T probably benign Het
Nfatc3 C T 8: 106,099,077 R587* probably null Het
Nin A T 12: 70,050,752 F516L probably damaging Het
Npm1 T A 11: 33,154,012 N272Y probably damaging Het
Ntrk3 T C 7: 78,198,842 E787G probably damaging Het
Olfr1093 G A 2: 86,785,996 V89I probably benign Het
Ppp1r21 A G 17: 88,549,816 E189G probably damaging Het
Prrc2c A T 1: 162,708,892 probably benign Het
Rrn3 T C 16: 13,782,100 probably null Het
Sec23ip C G 7: 128,776,850 T796S probably benign Het
Serpina3f T A 12: 104,217,140 I87N probably damaging Het
Slc22a27 G A 19: 7,910,049 T188I probably damaging Het
Triobp T A 15: 79,002,389 C1930* probably null Het
Ucp3 A G 7: 100,482,739 T266A probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn2r2 C T 3: 64,140,526 M6I probably benign Het
Vmn2r72 A T 7: 85,751,131 L237I probably benign Het
Zfp518a A C 19: 40,912,698 Q357P probably damaging Het
Other mutations in Evc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00663:Evc2 APN 5 37421891 missense probably benign 0.26
IGL01294:Evc2 APN 5 37347510 critical splice donor site probably null
IGL01547:Evc2 APN 5 37393087 missense probably benign 0.09
IGL02233:Evc2 APN 5 37378337 missense probably damaging 0.99
IGL02253:Evc2 APN 5 37378427 splice site probably benign
IGL02993:Evc2 APN 5 37419157 missense probably benign 0.01
R0010:Evc2 UTSW 5 37417449 missense probably damaging 1.00
R0010:Evc2 UTSW 5 37417449 missense probably damaging 1.00
R0324:Evc2 UTSW 5 37393099 missense probably damaging 1.00
R0441:Evc2 UTSW 5 37417467 missense probably damaging 1.00
R0454:Evc2 UTSW 5 37417484 missense possibly damaging 0.78
R1291:Evc2 UTSW 5 37386815 missense probably damaging 1.00
R1433:Evc2 UTSW 5 37393083 missense probably damaging 1.00
R1485:Evc2 UTSW 5 37370556 missense probably benign 0.30
R1491:Evc2 UTSW 5 37393197 critical splice donor site probably null
R1502:Evc2 UTSW 5 37393096 missense probably benign
R1662:Evc2 UTSW 5 37348750 missense probably benign 0.00
R1891:Evc2 UTSW 5 37392079 missense probably damaging 1.00
R1965:Evc2 UTSW 5 37363532 missense possibly damaging 0.73
R1983:Evc2 UTSW 5 37415931 nonsense probably null
R2160:Evc2 UTSW 5 37380518 missense possibly damaging 0.87
R2237:Evc2 UTSW 5 37378183 missense probably benign 0.22
R3926:Evc2 UTSW 5 37383230 missense probably damaging 1.00
R3953:Evc2 UTSW 5 37380587 critical splice donor site probably null
R4281:Evc2 UTSW 5 37338594 missense probably benign 0.33
R4366:Evc2 UTSW 5 37338669 missense possibly damaging 0.93
R4707:Evc2 UTSW 5 37421860 missense probably benign 0.08
R4754:Evc2 UTSW 5 37387031 missense probably damaging 0.99
R5373:Evc2 UTSW 5 37378210 missense probably damaging 1.00
R5593:Evc2 UTSW 5 37386977 missense probably damaging 0.99
R5697:Evc2 UTSW 5 37370608 missense probably damaging 1.00
R5847:Evc2 UTSW 5 37404724 intron probably benign
R5874:Evc2 UTSW 5 37417539 intron probably benign
R6023:Evc2 UTSW 5 37348616 missense probably benign 0.13
R6285:Evc2 UTSW 5 37424579 missense possibly damaging 0.86
R6394:Evc2 UTSW 5 37378275 missense probably damaging 1.00
R6567:Evc2 UTSW 5 37419164 missense probably benign 0.17
R6669:Evc2 UTSW 5 37378378 missense possibly damaging 0.88
R7039:Evc2 UTSW 5 37421888 missense probably damaging 1.00
R7131:Evc2 UTSW 5 37410258 missense probably damaging 1.00
R7144:Evc2 UTSW 5 37386839 missense probably damaging 0.97
R7372:Evc2 UTSW 5 37387133 missense probably damaging 0.98
R7376:Evc2 UTSW 5 37370639 missense possibly damaging 0.57
R7607:Evc2 UTSW 5 37386856 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TCCAGGGATGCTTAACCACAG -3'
(R):5'- AAAGTGAGAGGCCGGGTTACTC -3'

Sequencing Primer
(F):5'- CTTAACCACAGAGGGGTGCAC -3'
(R):5'- TCCTGAGGTCACCATGCAC -3'
Posted On2015-04-29