Incidental Mutation 'R3959:Ntrk3'
ID310835
Institutional Source Beutler Lab
Gene Symbol Ntrk3
Ensembl Gene ENSMUSG00000059146
Gene Nameneurotrophic tyrosine kinase, receptor, type 3
SynonymsTrkC
MMRRC Submission 040835-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3959 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location78175959-78738012 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 78198842 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 787 (E787G)
Ref Sequence ENSEMBL: ENSMUSP00000141599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039431] [ENSMUST00000193002] [ENSMUST00000195262]
Predicted Effect probably damaging
Transcript: ENSMUST00000039431
AA Change: E748G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037909
Gene: ENSMUSG00000059146
AA Change: E748G

DomainStartEndE-ValueType
LRRNT 31 63 2.46e-4 SMART
LRRCT 160 208 3.58e-12 SMART
IG 216 302 1.24e-8 SMART
Pfam:I-set 308 392 2.4e-8 PFAM
transmembrane domain 430 452 N/A INTRINSIC
TyrKc 538 810 1.49e-145 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000193002
AA Change: E762G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141534
Gene: ENSMUSG00000059146
AA Change: E762G

DomainStartEndE-ValueType
LRRNT 31 63 2.46e-4 SMART
LRRCT 160 208 3.58e-12 SMART
IG 216 302 1.24e-8 SMART
Pfam:I-set 308 392 2.4e-8 PFAM
Pfam:Ig_2 312 392 6.9e-4 PFAM
transmembrane domain 430 452 N/A INTRINSIC
TyrKc 538 824 4.29e-137 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000195262
AA Change: E787G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141599
Gene: ENSMUSG00000059146
AA Change: E787G

DomainStartEndE-ValueType
LRRNT 31 63 1.2e-6 SMART
LRRCT 160 208 1.8e-14 SMART
IG 216 302 5.1e-11 SMART
Pfam:I-set 308 392 4.7e-7 PFAM
Pfam:Ig_2 312 392 1.3e-2 PFAM
transmembrane domain 430 452 N/A INTRINSIC
TyrKc 538 849 9.7e-132 SMART
Meta Mutation Damage Score 0.9219 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurotrophic tyrosine receptor kinase (NTRK) family. This kinase is a membrane-bound receptor that, upon neurotrophin binding, phosphorylates itself and members of the MAPK pathway. Signalling through this kinase leads to cell differentiation and may play a role in the development of proprioceptive neurons that sense body position. Mutations in this gene have been associated with medulloblastomas, secretory breast carcinomas and other cancers. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2011]
PHENOTYPE: Homozygotes for targeted mutations show a range of phenotypes including postnatal death at 2-21 days, cardiac defects, reduced numbers of dorsal root ganglia neurons and germ cells, abnormal motor coordination and posture and abnormal sensory innervation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Adam26a T C 8: 43,569,871 H194R probably benign Het
Ccdc129 A T 6: 55,897,740 Q225L probably benign Het
Celf4 A G 18: 25,537,754 M124T probably benign Het
Csmd3 A T 15: 47,644,189 I2976K probably benign Het
Dnhd1 A G 7: 105,713,122 H3730R probably benign Het
Dock8 G A 19: 25,184,941 probably null Het
Eed C T 7: 89,954,941 R441Q probably benign Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Etl4 A G 2: 20,340,043 T53A probably benign Het
Evc2 T A 5: 37,415,776 V944E possibly damaging Het
Hmgcs2 T C 3: 98,297,477 F317S possibly damaging Het
Itpr2 C T 6: 146,425,510 V120I probably damaging Het
Mapk8 A C 14: 33,382,253 M402R probably null Het
Mycbp2 T C 14: 103,295,252 Y389C probably benign Het
Nceh1 T C 3: 27,279,196 I147T probably benign Het
Nfatc3 C T 8: 106,099,077 R587* probably null Het
Nin A T 12: 70,050,752 F516L probably damaging Het
Npm1 T A 11: 33,154,012 N272Y probably damaging Het
Olfr1093 G A 2: 86,785,996 V89I probably benign Het
Ppp1r21 A G 17: 88,549,816 E189G probably damaging Het
Prrc2c A T 1: 162,708,892 probably benign Het
Rrn3 T C 16: 13,782,100 probably null Het
Sec23ip C G 7: 128,776,850 T796S probably benign Het
Serpina3f T A 12: 104,217,140 I87N probably damaging Het
Slc22a27 G A 19: 7,910,049 T188I probably damaging Het
Triobp T A 15: 79,002,389 C1930* probably null Het
Ucp3 A G 7: 100,482,739 T266A probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn2r2 C T 3: 64,140,526 M6I probably benign Het
Vmn2r72 A T 7: 85,751,131 L237I probably benign Het
Zfp518a A C 19: 40,912,698 Q357P probably damaging Het
Other mutations in Ntrk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Ntrk3 APN 7 78250873 missense probably benign 0.03
IGL00862:Ntrk3 APN 7 78247177 missense probably damaging 1.00
IGL00972:Ntrk3 APN 7 78247322 missense possibly damaging 0.95
IGL00976:Ntrk3 APN 7 78450953 missense probably benign 0.02
IGL02172:Ntrk3 APN 7 78460272 splice site probably benign
IGL02175:Ntrk3 APN 7 78247228 missense probably damaging 1.00
IGL02213:Ntrk3 APN 7 78462931 missense probably benign 0.17
IGL02363:Ntrk3 APN 7 78453337 missense probably benign 0.24
IGL02527:Ntrk3 APN 7 78451949 missense probably benign
IGL02673:Ntrk3 APN 7 78250764 missense probably damaging 1.00
IGL02755:Ntrk3 APN 7 78460439 missense probably benign
IGL02998:Ntrk3 APN 7 78577657 missense probably damaging 0.98
IGL03235:Ntrk3 APN 7 78192592 missense probably damaging 1.00
R1465:Ntrk3 UTSW 7 78356014 splice site probably benign
R1505:Ntrk3 UTSW 7 78460524 missense probably damaging 0.99
R1638:Ntrk3 UTSW 7 78247288 missense probably damaging 1.00
R1641:Ntrk3 UTSW 7 78356074 missense probably damaging 1.00
R1775:Ntrk3 UTSW 7 78356041 missense possibly damaging 0.60
R1786:Ntrk3 UTSW 7 78477935 splice site probably benign
R1827:Ntrk3 UTSW 7 78247301 missense probably damaging 1.00
R1868:Ntrk3 UTSW 7 78192604 missense possibly damaging 0.90
R1873:Ntrk3 UTSW 7 78462839 missense probably benign
R1929:Ntrk3 UTSW 7 78516723 splice site probably null
R1941:Ntrk3 UTSW 7 78247262 missense probably damaging 1.00
R2132:Ntrk3 UTSW 7 78477935 splice site probably benign
R2214:Ntrk3 UTSW 7 78516772 missense probably damaging 1.00
R2221:Ntrk3 UTSW 7 78198852 missense probably damaging 1.00
R2223:Ntrk3 UTSW 7 78198852 missense probably damaging 1.00
R2271:Ntrk3 UTSW 7 78516723 splice site probably null
R2441:Ntrk3 UTSW 7 78302662 missense probably damaging 1.00
R3108:Ntrk3 UTSW 7 78460515 missense probably benign 0.01
R3109:Ntrk3 UTSW 7 78460515 missense probably benign 0.01
R4016:Ntrk3 UTSW 7 78462947 splice site probably benign
R4028:Ntrk3 UTSW 7 78192710 missense probably damaging 1.00
R4067:Ntrk3 UTSW 7 78517437 missense probably damaging 1.00
R4398:Ntrk3 UTSW 7 78250769 nonsense probably null
R4664:Ntrk3 UTSW 7 78461099 missense probably damaging 0.99
R5045:Ntrk3 UTSW 7 78460424 missense probably benign 0.13
R5081:Ntrk3 UTSW 7 78577774 missense probably damaging 0.99
R5151:Ntrk3 UTSW 7 78247300 missense probably damaging 1.00
R5249:Ntrk3 UTSW 7 78461166 missense possibly damaging 0.87
R5294:Ntrk3 UTSW 7 78517506 splice site probably null
R5594:Ntrk3 UTSW 7 78451899 missense probably benign 0.10
R5923:Ntrk3 UTSW 7 78451928 missense possibly damaging 0.61
R6878:Ntrk3 UTSW 7 78304372 missense probably benign 0.00
R7083:Ntrk3 UTSW 7 78250839 missense probably damaging 1.00
R7178:Ntrk3 UTSW 7 78356147 missense possibly damaging 0.86
R7487:Ntrk3 UTSW 7 78250713 missense probably damaging 1.00
R7607:Ntrk3 UTSW 7 78250873 missense probably benign 0.03
R7800:Ntrk3 UTSW 7 78302740 missense probably benign 0.09
R8009:Ntrk3 UTSW 7 78453328 missense probably benign
R8032:Ntrk3 UTSW 7 78356059 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCATCCACTTTGCTATCTTGACAG -3'
(R):5'- AGCATGGCCATGTTGGGATC -3'

Sequencing Primer
(F):5'- AGCCCACCTATCTGCATACTATATG -3'
(R):5'- CCATGTTGGGATCCAGTGC -3'
Posted On2015-04-29