Mutagenetix > Incidental Mutation

Incidental Mutation 'R3959:Vmn2r72'

310836

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r72

Ensembl Gene

ENSMUSG00000051877

Gene Name

vomeronasal 2, receptor 72

Synonyms

Vmn2r72-ps, EG244114

MMRRC Submission

040835-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.105) question?

Stock #

R3959 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

85737784-85754981 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 85751131 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Isoleucine at position 237 (L237I)

Ref Sequence

ENSEMBL: ENSMUSP00000133014 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000063425]

AlphaFold

D3Z4N8

Predicted Effect

probably benign
Transcript: ENSMUST00000063425
AA Change: L237I

PolyPhen 2 Score 0.361 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000133014
Gene: ENSMUSG00000051877
AA Change: L237I

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	82	469	2.3e-28	PFAM
Pfam:NCD3G	512	564	1.2e-18	PFAM
Pfam:7tm_3	594	832	4e-53	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 93.7%

Validation Efficiency

100% (37/37)

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	G	T	12: 71,164,546	E685*	probably null	Het
2700049A03Rik	A	T	12: 71,164,547	E685V	possibly damaging	Het
Adam26a	T	C	8: 43,569,871	H194R	probably benign	Het
Ccdc129	A	T	6: 55,897,740	Q225L	probably benign	Het
Celf4	A	G	18: 25,537,754	M124T	probably benign	Het
Csmd3	A	T	15: 47,644,189	I2976K	probably benign	Het
Dnhd1	A	G	7: 105,713,122	H3730R	probably benign	Het
Dock8	G	A	19: 25,184,941		probably null	Het
Eed	C	T	7: 89,954,941	R441Q	probably benign	Het
Espl1	A	G	15: 102,312,989	I944V	probably damaging	Het
Etl4	A	G	2: 20,340,043	T53A	probably benign	Het
Evc2	T	A	5: 37,415,776	V944E	possibly damaging	Het
Hmgcs2	T	C	3: 98,297,477	F317S	possibly damaging	Het
Itpr2	C	T	6: 146,425,510	V120I	probably damaging	Het
Mapk8	A	C	14: 33,382,253	M402R	probably null	Het
Mycbp2	T	C	14: 103,295,252	Y389C	probably benign	Het
Nceh1	T	C	3: 27,279,196	I147T	probably benign	Het
Nfatc3	C	T	8: 106,099,077	R587*	probably null	Het
Nin	A	T	12: 70,050,752	F516L	probably damaging	Het
Npm1	T	A	11: 33,154,012	N272Y	probably damaging	Het
Ntrk3	T	C	7: 78,198,842	E787G	probably damaging	Het
Olfr1093	G	A	2: 86,785,996	V89I	probably benign	Het
Ppp1r21	A	G	17: 88,549,816	E189G	probably damaging	Het
Prrc2c	A	T	1: 162,708,892		probably benign	Het
Rrn3	T	C	16: 13,782,100		probably null	Het
Sec23ip	C	G	7: 128,776,850	T796S	probably benign	Het
Serpina3f	T	A	12: 104,217,140	I87N	probably damaging	Het
Slc22a27	G	A	19: 7,910,049	T188I	probably damaging	Het
Triobp	T	A	15: 79,002,389	C1930*	probably null	Het
Ucp3	A	G	7: 100,482,739	T266A	probably benign	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Vmn2r2	C	T	3: 64,140,526	M6I	probably benign	Het
Zfp518a	A	C	19: 40,912,698	Q357P	probably damaging	Het

Other mutations in Vmn2r72

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00931:Vmn2r72	APN	7	85749646	missense	probably benign	0.01
IGL01019:Vmn2r72	APN	7	85738334	missense	probably benign	0.26
IGL01445:Vmn2r72	APN	7	85749646	missense	probably benign	0.06
IGL02076:Vmn2r72	APN	7	85738367	missense	probably damaging	1.00
IGL02082:Vmn2r72	APN	7	85738166	missense	probably benign	0.00
IGL02086:Vmn2r72	APN	7	85738166	missense	probably benign	0.00
IGL02089:Vmn2r72	APN	7	85738166	missense	probably benign	0.00
IGL02125:Vmn2r72	APN	7	85750711	missense	probably benign	0.00
IGL02146:Vmn2r72	APN	7	85737962	missense	probably damaging	1.00
IGL02272:Vmn2r72	APN	7	85750693	missense	probably benign
IGL02514:Vmn2r72	APN	7	85738699	missense	possibly damaging	0.90
IGL02662:Vmn2r72	APN	7	85738183	missense	probably benign	0.26
IGL02697:Vmn2r72	APN	7	85738671	missense	probably benign	0.36
IGL02733:Vmn2r72	APN	7	85751813	missense	probably benign	0.05
IGL03070:Vmn2r72	APN	7	85752041	splice site	probably benign
IGL03150:Vmn2r72	APN	7	85751176	missense	probably damaging	1.00
IGL03159:Vmn2r72	APN	7	85754954	missense	probably benign	0.05
IGL03333:Vmn2r72	APN	7	85750867	missense	probably benign	0.10
R0081:Vmn2r72	UTSW	7	85751836	missense	probably benign	0.01
R0090:Vmn2r72	UTSW	7	85754876	missense	probably benign
R0655:Vmn2r72	UTSW	7	85738111	nonsense	probably null
R0778:Vmn2r72	UTSW	7	85749739	missense	probably benign	0.00
R1169:Vmn2r72	UTSW	7	85751309	missense	probably benign	0.01
R1172:Vmn2r72	UTSW	7	85751944	missense	probably damaging	1.00
R1173:Vmn2r72	UTSW	7	85751944	missense	probably damaging	1.00
R1175:Vmn2r72	UTSW	7	85751944	missense	probably damaging	1.00
R1248:Vmn2r72	UTSW	7	85749188	missense	probably benign	0.02
R1302:Vmn2r72	UTSW	7	85738257	missense	probably damaging	1.00
R1506:Vmn2r72	UTSW	7	85749211	missense	probably benign
R1632:Vmn2r72	UTSW	7	85751792	missense	probably benign	0.13
R1775:Vmn2r72	UTSW	7	85738170	missense	probably benign	0.01
R1962:Vmn2r72	UTSW	7	85749161	missense	probably benign	0.00
R2201:Vmn2r72	UTSW	7	85738236	missense	probably benign	0.12
R2290:Vmn2r72	UTSW	7	85738341	missense	probably damaging	1.00
R2327:Vmn2r72	UTSW	7	85738256	missense	probably damaging	1.00
R2424:Vmn2r72	UTSW	7	85750953	missense	probably damaging	1.00
R2655:Vmn2r72	UTSW	7	85751269	missense	possibly damaging	0.95
R2860:Vmn2r72	UTSW	7	85750836	missense	probably damaging	0.99
R2861:Vmn2r72	UTSW	7	85750836	missense	probably damaging	0.99
R2862:Vmn2r72	UTSW	7	85750836	missense	probably damaging	0.99
R3009:Vmn2r72	UTSW	7	85749642	missense	probably benign	0.00
R3797:Vmn2r72	UTSW	7	85738077	missense	probably benign	0.44
R3798:Vmn2r72	UTSW	7	85738077	missense	probably benign	0.44
R3902:Vmn2r72	UTSW	7	85749735	missense	possibly damaging	0.52
R3974:Vmn2r72	UTSW	7	85749809	missense	probably damaging	1.00
R4399:Vmn2r72	UTSW	7	85738500	missense	probably damaging	1.00
R4421:Vmn2r72	UTSW	7	85738500	missense	probably damaging	1.00
R4426:Vmn2r72	UTSW	7	85737828	nonsense	probably null
R4522:Vmn2r72	UTSW	7	85751926	missense	probably benign	0.44
R4523:Vmn2r72	UTSW	7	85751926	missense	probably benign	0.44
R4533:Vmn2r72	UTSW	7	85751926	missense	probably benign	0.44
R4691:Vmn2r72	UTSW	7	85737911	nonsense	probably null
R4781:Vmn2r72	UTSW	7	85737861	missense	probably benign	0.14
R4863:Vmn2r72	UTSW	7	85750598	missense	possibly damaging	0.91
R4952:Vmn2r72	UTSW	7	85751109	missense	probably benign
R4991:Vmn2r72	UTSW	7	85751130	missense	probably damaging	0.99
R4995:Vmn2r72	UTSW	7	85738485	missense	probably damaging	1.00
R5095:Vmn2r72	UTSW	7	85737853	missense	probably damaging	0.98
R5174:Vmn2r72	UTSW	7	85737840	missense	probably benign	0.00
R5276:Vmn2r72	UTSW	7	85738254	missense	possibly damaging	0.90
R5395:Vmn2r72	UTSW	7	85750897	missense	possibly damaging	0.71
R5560:Vmn2r72	UTSW	7	85751942	missense	probably damaging	0.96
R5933:Vmn2r72	UTSW	7	85737850	missense	probably benign	0.05
R6033:Vmn2r72	UTSW	7	85737929	missense	probably damaging	1.00
R6033:Vmn2r72	UTSW	7	85737929	missense	probably damaging	1.00
R6354:Vmn2r72	UTSW	7	85750539	critical splice donor site	probably null
R6362:Vmn2r72	UTSW	7	85751174	missense	probably damaging	1.00
R6594:Vmn2r72	UTSW	7	85749684	missense	probably benign	0.32
R6794:Vmn2r72	UTSW	7	85737996	missense	probably damaging	1.00
R7113:Vmn2r72	UTSW	7	85749803	splice site	probably null
R7189:Vmn2r72	UTSW	7	85754917	missense	probably benign	0.36
R7266:Vmn2r72	UTSW	7	85738274	nonsense	probably null
R7323:Vmn2r72	UTSW	7	85750563	missense	probably benign
R7426:Vmn2r72	UTSW	7	85751140	missense	probably benign
R7606:Vmn2r72	UTSW	7	85751154	missense	possibly damaging	0.91
R7651:Vmn2r72	UTSW	7	85751938	missense	probably damaging	1.00
R7688:Vmn2r72	UTSW	7	85754890	missense	probably benign	0.32
R7753:Vmn2r72	UTSW	7	85750626	missense	probably damaging	1.00
R7843:Vmn2r72	UTSW	7	85749630	missense	probably benign	0.01
R8157:Vmn2r72	UTSW	7	85751233	missense	probably benign	0.09
R8254:Vmn2r72	UTSW	7	85751019	missense	probably damaging	1.00
R8389:Vmn2r72	UTSW	7	85751960	missense	probably damaging	0.99
R8444:Vmn2r72	UTSW	7	85738175	missense	probably benign
R8989:Vmn2r72	UTSW	7	85754926	missense	probably benign	0.10
R9015:Vmn2r72	UTSW	7	85749180	missense	probably benign	0.01
R9080:Vmn2r72	UTSW	7	85738256	missense	probably damaging	1.00
R9269:Vmn2r72	UTSW	7	85751203	missense	probably benign	0.03
R9317:Vmn2r72	UTSW	7	85754814	missense	probably benign	0.04
R9509:Vmn2r72	UTSW	7	85754867	missense	probably benign
Z1176:Vmn2r72	UTSW	7	85749191	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGTCCCAGAGGAGGAATATAGCATG -3'
(R):5'- GAGCAATTTCCTCACCTTTACCAG -3'

Sequencing Primer
(F):5'- TTGTGACACACTAACCCAGATTC -3'
(R):5'- TCACCTTTACCAGATATCTCCAAAGG -3'

Posted On

2015-04-29