Incidental Mutation 'R3959:Mapk8'
ID310851
Institutional Source Beutler Lab
Gene Symbol Mapk8
Ensembl Gene ENSMUSG00000021936
Gene Namemitogen-activated protein kinase 8
SynonymsJNK1, c-Jun N-terminal kinase, Prkm8
MMRRC Submission 040835-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.566) question?
Stock #R3959 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location33377898-33447158 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 33382253 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 402 (M402R)
Ref Sequence ENSEMBL: ENSMUSP00000107575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022504] [ENSMUST00000111942] [ENSMUST00000111943] [ENSMUST00000111944] [ENSMUST00000111945]
Predicted Effect probably null
Transcript: ENSMUST00000022504
AA Change: M402R

PolyPhen 2 Score 0.190 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000022504
Gene: ENSMUSG00000021936
AA Change: M402R

DomainStartEndE-ValueType
S_TKc 26 321 1.3e-86 SMART
low complexity region 390 403 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111942
SMART Domains Protein: ENSMUSP00000107573
Gene: ENSMUSG00000021936

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 26 208 1.8e-25 PFAM
Pfam:Pkinase 26 210 5.2e-48 PFAM
Pfam:Kdo 33 178 6.4e-9 PFAM
SCOP:d1pme__ 216 286 2e-17 SMART
PDB:3GP0|A 218 288 4e-11 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000111943
SMART Domains Protein: ENSMUSP00000107574
Gene: ENSMUSG00000021936

DomainStartEndE-ValueType
S_TKc 26 321 1.3e-86 SMART
Predicted Effect probably null
Transcript: ENSMUST00000111944
AA Change: M402R

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000107575
Gene: ENSMUSG00000021936
AA Change: M402R

DomainStartEndE-ValueType
S_TKc 26 321 1.06e-86 SMART
low complexity region 390 403 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111945
SMART Domains Protein: ENSMUSP00000107576
Gene: ENSMUSG00000021936

DomainStartEndE-ValueType
S_TKc 26 321 1.06e-86 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127143
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150659
Meta Mutation Damage Score 0.1986 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the MAP kinase family. MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. This kinase is activated by various cell stimuli, and targets specific transcription factors, and thus mediates immediate-early gene expression in response to cell stimuli. The activation of this kinase by tumor-necrosis factor alpha (TNF-alpha) is found to be required for TNF-alpha induced apoptosis. This kinase is also involved in UV radiation induced apoptosis, which is thought to be related to cytochrom c-mediated cell death pathway. Studies of the mouse counterpart of this gene suggested that this kinase play a key role in T cell proliferation, apoptosis and differentiation. Several alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal T cell differentiation and proliferation, cardiac morphology and physiology, and chemically-induced tumorigenesis. Mice homozygous for another knock-out allele exhibit abnormal glucose homeostasis and T cell physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Adam26a T C 8: 43,569,871 H194R probably benign Het
Ccdc129 A T 6: 55,897,740 Q225L probably benign Het
Celf4 A G 18: 25,537,754 M124T probably benign Het
Csmd3 A T 15: 47,644,189 I2976K probably benign Het
Dnhd1 A G 7: 105,713,122 H3730R probably benign Het
Dock8 G A 19: 25,184,941 probably null Het
Eed C T 7: 89,954,941 R441Q probably benign Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Etl4 A G 2: 20,340,043 T53A probably benign Het
Evc2 T A 5: 37,415,776 V944E possibly damaging Het
Hmgcs2 T C 3: 98,297,477 F317S possibly damaging Het
Itpr2 C T 6: 146,425,510 V120I probably damaging Het
Mycbp2 T C 14: 103,295,252 Y389C probably benign Het
Nceh1 T C 3: 27,279,196 I147T probably benign Het
Nfatc3 C T 8: 106,099,077 R587* probably null Het
Nin A T 12: 70,050,752 F516L probably damaging Het
Npm1 T A 11: 33,154,012 N272Y probably damaging Het
Ntrk3 T C 7: 78,198,842 E787G probably damaging Het
Olfr1093 G A 2: 86,785,996 V89I probably benign Het
Ppp1r21 A G 17: 88,549,816 E189G probably damaging Het
Prrc2c A T 1: 162,708,892 probably benign Het
Rrn3 T C 16: 13,782,100 probably null Het
Sec23ip C G 7: 128,776,850 T796S probably benign Het
Serpina3f T A 12: 104,217,140 I87N probably damaging Het
Slc22a27 G A 19: 7,910,049 T188I probably damaging Het
Triobp T A 15: 79,002,389 C1930* probably null Het
Ucp3 A G 7: 100,482,739 T266A probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn2r2 C T 3: 64,140,526 M6I probably benign Het
Vmn2r72 A T 7: 85,751,131 L237I probably benign Het
Zfp518a A C 19: 40,912,698 Q357P probably damaging Het
Other mutations in Mapk8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01478:Mapk8 APN 14 33383900 missense probably benign 0.01
R0255:Mapk8 UTSW 14 33387307 splice site probably benign
R0401:Mapk8 UTSW 14 33382208 missense probably benign 0.37
R0862:Mapk8 UTSW 14 33392992 missense probably damaging 0.98
R0864:Mapk8 UTSW 14 33392992 missense probably damaging 0.98
R1084:Mapk8 UTSW 14 33388803 nonsense probably null
R1637:Mapk8 UTSW 14 33410962 missense probably benign 0.00
R2038:Mapk8 UTSW 14 33388936 nonsense probably null
R4087:Mapk8 UTSW 14 33390248 missense probably benign 0.00
R4181:Mapk8 UTSW 14 33382220 missense probably damaging 1.00
R4183:Mapk8 UTSW 14 33382220 missense probably damaging 1.00
R4184:Mapk8 UTSW 14 33382220 missense probably damaging 1.00
R5366:Mapk8 UTSW 14 33390729 missense probably damaging 1.00
R6076:Mapk8 UTSW 14 33390293 missense probably damaging 1.00
R6991:Mapk8 UTSW 14 33410884 missense possibly damaging 0.82
R7345:Mapk8 UTSW 14 33408111 missense probably damaging 0.99
R7814:Mapk8 UTSW 14 33410877 nonsense probably null
Z1176:Mapk8 UTSW 14 33410886 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAAGTCACCACATAATAGTTGC -3'
(R):5'- GCCCAGGAGAAGTCTATAGACC -3'

Sequencing Primer
(F):5'- CAGTTTTGTTGCTGTTTAAAAACAC -3'
(R):5'- CCAGGAGAAGTCTATAGACCCTGAAG -3'
Posted On2015-04-29