Incidental Mutation 'R3959:Rrn3'
ID 310856
Institutional Source Beutler Lab
Gene Symbol Rrn3
Ensembl Gene ENSMUSG00000022682
Gene Name RRN3 RNA polymerase I transcription factor homolog (yeast)
Synonyms TIF-1A, E130302O19Rik
MMRRC Submission 040835-MU
Accession Numbers

Genbank: NM_001039521; MGI: 1925255
Essential gene? Essential (E-score: 1.000) question?
Stock # R3959 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 13780708-13814839 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 13782100 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000023363 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023363]
AlphaFold B2RS91
Predicted Effect probably null
Transcript: ENSMUST00000023363
SMART Domains Protein: ENSMUSP00000023363
Gene: ENSMUSG00000022682

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
Pfam:RRN3 46 584 7.5e-138 PFAM
low complexity region 597 605 N/A INTRINSIC
low complexity region 631 641 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230102
Meta Mutation Damage Score 0.9590 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency 100% (37/37)
MGI Phenotype PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis, failure to undergo embryonic turning, delayed embryonic development, markedly reduced embryo size, and increased apoptosis. [provided by MGI curators]
Allele List at MGI

All alleles(38) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(36)
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Adam26a T C 8: 43,569,871 H194R probably benign Het
Ccdc129 A T 6: 55,897,740 Q225L probably benign Het
Celf4 A G 18: 25,537,754 M124T probably benign Het
Csmd3 A T 15: 47,644,189 I2976K probably benign Het
Dnhd1 A G 7: 105,713,122 H3730R probably benign Het
Dock8 G A 19: 25,184,941 probably null Het
Eed C T 7: 89,954,941 R441Q probably benign Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Etl4 A G 2: 20,340,043 T53A probably benign Het
Evc2 T A 5: 37,415,776 V944E possibly damaging Het
Hmgcs2 T C 3: 98,297,477 F317S possibly damaging Het
Itpr2 C T 6: 146,425,510 V120I probably damaging Het
Mapk8 A C 14: 33,382,253 M402R probably null Het
Mycbp2 T C 14: 103,295,252 Y389C probably benign Het
Nceh1 T C 3: 27,279,196 I147T probably benign Het
Nfatc3 C T 8: 106,099,077 R587* probably null Het
Nin A T 12: 70,050,752 F516L probably damaging Het
Npm1 T A 11: 33,154,012 N272Y probably damaging Het
Ntrk3 T C 7: 78,198,842 E787G probably damaging Het
Olfr1093 G A 2: 86,785,996 V89I probably benign Het
Ppp1r21 A G 17: 88,549,816 E189G probably damaging Het
Prrc2c A T 1: 162,708,892 probably benign Het
Sec23ip C G 7: 128,776,850 T796S probably benign Het
Serpina3f T A 12: 104,217,140 I87N probably damaging Het
Slc22a27 G A 19: 7,910,049 T188I probably damaging Het
Triobp T A 15: 79,002,389 C1930* probably null Het
Ucp3 A G 7: 100,482,739 T266A probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn2r2 C T 3: 64,140,526 M6I probably benign Het
Vmn2r72 A T 7: 85,751,131 L237I probably benign Het
Zfp518a A C 19: 40,912,698 Q357P probably damaging Het
Other mutations in Rrn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01085:Rrn3 APN 16 13809062 missense probably damaging 1.00
IGL02507:Rrn3 APN 16 13788857 missense probably benign
IGL02607:Rrn3 APN 16 13806563 missense possibly damaging 0.65
IGL02648:Rrn3 APN 16 13811589 missense probably benign
IGL03217:Rrn3 APN 16 13809011 missense possibly damaging 0.83
IGL03403:Rrn3 APN 16 13799945 nonsense probably null
11287:Rrn3 UTSW 16 13800019 splice site probably null
ANU74:Rrn3 UTSW 16 13811533 missense possibly damaging 0.65
R0013:Rrn3 UTSW 16 13813113 missense possibly damaging 0.92
R0013:Rrn3 UTSW 16 13813113 missense possibly damaging 0.92
R0308:Rrn3 UTSW 16 13799882 splice site probably benign
R1970:Rrn3 UTSW 16 13789074 missense probably damaging 1.00
R3712:Rrn3 UTSW 16 13784095 nonsense probably null
R4343:Rrn3 UTSW 16 13784122 missense probably benign 0.01
R4678:Rrn3 UTSW 16 13796076 missense probably damaging 1.00
R4920:Rrn3 UTSW 16 13790639 missense probably benign 0.01
R4925:Rrn3 UTSW 16 13799972 missense probably damaging 1.00
R5225:Rrn3 UTSW 16 13792934 splice site probably null
R5469:Rrn3 UTSW 16 13813100 missense probably benign 0.01
R5702:Rrn3 UTSW 16 13813266 nonsense probably null
R6059:Rrn3 UTSW 16 13806604 missense probably benign
R6425:Rrn3 UTSW 16 13811601 missense probably benign 0.00
R7582:Rrn3 UTSW 16 13810511 nonsense probably null
R7814:Rrn3 UTSW 16 13811589 missense probably benign
R8332:Rrn3 UTSW 16 13798620 missense possibly damaging 0.61
R9315:Rrn3 UTSW 16 13788826 missense probably benign 0.00
R9752:Rrn3 UTSW 16 13813231 missense probably benign
R9757:Rrn3 UTSW 16 13810569 missense probably damaging 0.96
Z1176:Rrn3 UTSW 16 13813156 missense probably damaging 1.00
Z1177:Rrn3 UTSW 16 13788846 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CACAAAATGATGTTGGCTCAGC -3'
(R):5'- ACTAGACCTGTTTTCCTGGTG -3'

Sequencing Primer
(F):5'- GCTCAGCCATGCTCCCTG -3'
(R):5'- GCTCTTCGGTTTAATGCCT -3'
Posted On 2015-04-29