Incidental Mutation 'R3959:Celf4'
ID310858
Institutional Source Beutler Lab
Gene Symbol Celf4
Ensembl Gene ENSMUSG00000024268
Gene NameCUGBP, Elav-like family member 4
SynonymsBrunol4, Brul4, BRUNOL-4, A230070D14Rik, C130060B05Rik
MMRRC Submission 040835-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3959 (G1)
Quality Score203
Status Validated
Chromosome18
Chromosomal Location25477632-25754157 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25537754 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 124 (M124T)
Ref Sequence ENSEMBL: ENSMUSP00000153226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025117] [ENSMUST00000115816] [ENSMUST00000223704] [ENSMUST00000224553] [ENSMUST00000225477]
Predicted Effect probably benign
Transcript: ENSMUST00000025117
AA Change: M124T

PolyPhen 2 Score 0.083 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000025117
Gene: ENSMUSG00000024268
AA Change: M124T

DomainStartEndE-ValueType
RRM 55 131 2.94e-21 SMART
RRM 152 227 3.56e-20 SMART
low complexity region 237 249 N/A INTRINSIC
low complexity region 258 276 N/A INTRINSIC
low complexity region 287 309 N/A INTRINSIC
low complexity region 312 322 N/A INTRINSIC
low complexity region 376 396 N/A INTRINSIC
low complexity region 399 412 N/A INTRINSIC
RRM 420 473 5.29e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115816
AA Change: M124T

PolyPhen 2 Score 0.083 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000111483
Gene: ENSMUSG00000024268
AA Change: M124T

DomainStartEndE-ValueType
RRM 55 131 2.94e-21 SMART
RRM 152 227 3.56e-20 SMART
low complexity region 237 249 N/A INTRINSIC
low complexity region 258 276 N/A INTRINSIC
low complexity region 287 309 N/A INTRINSIC
low complexity region 312 322 N/A INTRINSIC
low complexity region 376 396 N/A INTRINSIC
low complexity region 399 412 N/A INTRINSIC
RRM 420 493 5.88e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000223704
AA Change: M124T

PolyPhen 2 Score 0.083 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000224553
AA Change: M124T

PolyPhen 2 Score 0.083 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000225477
AA Change: M124T

PolyPhen 2 Score 0.083 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225927
Meta Mutation Damage Score 0.3550 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the CELF/BRUNOL protein family contain two N-terminal RNA recognition motif (RRM) domains, one C-terminal RRM domain, and a divergent segment of 160-230 aa between the second and third RRM domains. Members of this protein family regulate pre-mRNA alternative splicing and may also be involved in mRNA editing, and translation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality, shortened life span dependent on genetic background, and seizures. Mice heterozygous for a null allele exhibit complex seizures and abnormal body weights depending on age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Adam26a T C 8: 43,569,871 H194R probably benign Het
Ccdc129 A T 6: 55,897,740 Q225L probably benign Het
Csmd3 A T 15: 47,644,189 I2976K probably benign Het
Dnhd1 A G 7: 105,713,122 H3730R probably benign Het
Dock8 G A 19: 25,184,941 probably null Het
Eed C T 7: 89,954,941 R441Q probably benign Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Etl4 A G 2: 20,340,043 T53A probably benign Het
Evc2 T A 5: 37,415,776 V944E possibly damaging Het
Hmgcs2 T C 3: 98,297,477 F317S possibly damaging Het
Itpr2 C T 6: 146,425,510 V120I probably damaging Het
Mapk8 A C 14: 33,382,253 M402R probably null Het
Mycbp2 T C 14: 103,295,252 Y389C probably benign Het
Nceh1 T C 3: 27,279,196 I147T probably benign Het
Nfatc3 C T 8: 106,099,077 R587* probably null Het
Nin A T 12: 70,050,752 F516L probably damaging Het
Npm1 T A 11: 33,154,012 N272Y probably damaging Het
Ntrk3 T C 7: 78,198,842 E787G probably damaging Het
Olfr1093 G A 2: 86,785,996 V89I probably benign Het
Ppp1r21 A G 17: 88,549,816 E189G probably damaging Het
Prrc2c A T 1: 162,708,892 probably benign Het
Rrn3 T C 16: 13,782,100 probably null Het
Sec23ip C G 7: 128,776,850 T796S probably benign Het
Serpina3f T A 12: 104,217,140 I87N probably damaging Het
Slc22a27 G A 19: 7,910,049 T188I probably damaging Het
Triobp T A 15: 79,002,389 C1930* probably null Het
Ucp3 A G 7: 100,482,739 T266A probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn2r2 C T 3: 64,140,526 M6I probably benign Het
Vmn2r72 A T 7: 85,751,131 L237I probably benign Het
Zfp518a A C 19: 40,912,698 Q357P probably damaging Het
Other mutations in Celf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Celf4 APN 18 25486950 missense probably damaging 1.00
IGL01608:Celf4 APN 18 25497503 missense probably damaging 1.00
IGL02353:Celf4 APN 18 25486898 missense probably damaging 1.00
IGL02360:Celf4 APN 18 25486898 missense probably damaging 1.00
IGL02614:Celf4 APN 18 25504150 missense probably damaging 1.00
IGL03183:Celf4 APN 18 25537739 missense probably benign 0.05
IGL03183:Celf4 APN 18 25537740 missense probably benign 0.22
R1141:Celf4 UTSW 18 25504904 missense probably damaging 0.99
R1448:Celf4 UTSW 18 25503083 splice site probably null
R2442:Celf4 UTSW 18 25753459 missense probably damaging 1.00
R3958:Celf4 UTSW 18 25537754 missense probably benign 0.08
R3960:Celf4 UTSW 18 25537754 missense probably benign 0.08
R4256:Celf4 UTSW 18 25491201 missense probably damaging 0.97
R4650:Celf4 UTSW 18 25496245 missense possibly damaging 0.79
R6521:Celf4 UTSW 18 25479474 splice site probably null
R6945:Celf4 UTSW 18 25496236 missense probably damaging 1.00
R7724:Celf4 UTSW 18 25486793 critical splice donor site probably null
R7834:Celf4 UTSW 18 25753485 missense probably benign 0.04
R8000:Celf4 UTSW 18 25504517 missense probably benign 0.00
R8403:Celf4 UTSW 18 25504270 missense possibly damaging 0.90
RF048:Celf4 UTSW 18 25501321 missense probably benign 0.02
Z1088:Celf4 UTSW 18 25496249 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TGCTAGCCTTCAGTTCTGAGAG -3'
(R):5'- CGAAATACTGGGCTGTGGAG -3'

Sequencing Primer
(F):5'- CCTTCAGTTCTGAGAGGGAGCAG -3'
(R):5'- GCACTTGCGAACTTTAGC -3'
Posted On2015-04-29