Incidental Mutation 'R3969:E2f1'
ID 310866
Institutional Source Beutler Lab
Gene Symbol E2f1
Ensembl Gene ENSMUSG00000027490
Gene Name E2F transcription factor 1
Synonyms E2F-1
MMRRC Submission 040937-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.858) question?
Stock # R3969 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 154401327-154411812 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to G at 154405942 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Arginine at position 144 (G144R)
Ref Sequence ENSEMBL: ENSMUSP00000099434 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000894] [ENSMUST00000103145]
AlphaFold Q61501
Predicted Effect probably damaging
Transcript: ENSMUST00000000894
AA Change: G99R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000894
Gene: ENSMUSG00000027490
AA Change: G99R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:E2F_TDP 77 142 1.1e-25 PFAM
low complexity region 156 173 N/A INTRINSIC
low complexity region 273 295 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000103145
AA Change: G144R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099434
Gene: ENSMUSG00000027490
AA Change: G144R

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
low complexity region 62 82 N/A INTRINSIC
E2F_TDP 122 187 1.63e-30 SMART
Pfam:E2F_CC-MB 201 294 2.2e-37 PFAM
low complexity region 318 340 N/A INTRINSIC
Meta Mutation Damage Score 0.6284 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the E2F family of transcription factors. The E2F family plays a crucial role in the control of cell cycle and action of tumor suppressor proteins and is also a target of the transforming proteins of small DNA tumor viruses. The E2F proteins contain several evolutionally conserved domains found in most members of the family. These domains include a DNA binding domain, a dimerization domain which determines interaction with the differentiation regulated transcription factor proteins (DP), a transactivation domain enriched in acidic amino acids, and a tumor suppressor protein association domain which is embedded within the transactivation domain. This protein and another 2 members, E2F2 and E2F3, have an additional cyclin binding domain. This protein binds preferentially to retinoblastoma protein pRB in a cell-cycle dependent manner. It can mediate both cell proliferation and p53-dependent/independent apoptosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants show defective T lymphocyte development, impaired pancreatic growth and beta cell function, altered glucose homeostasis, testicular atrophy, salivary gland and adipose tissue defects, and increased tumor induction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahi1 A G 10: 20,835,846 (GRCm39) K60E probably damaging Het
Arhgef12 C A 9: 42,916,847 (GRCm39) R432L probably damaging Het
Armcx6 G T X: 133,650,505 (GRCm39) H109N possibly damaging Het
Camk2d G T 3: 126,590,608 (GRCm39) C273F possibly damaging Het
Camk4 T A 18: 33,312,634 (GRCm39) I258N possibly damaging Het
Chia1 T G 3: 106,028,951 (GRCm39) probably null Het
Commd9 C A 2: 101,727,486 (GRCm39) N93K probably benign Het
Cpeb4 T C 11: 31,822,811 (GRCm39) I175T possibly damaging Het
Dnah17 G A 11: 117,931,984 (GRCm39) probably benign Het
Faap100 A T 11: 120,269,531 (GRCm39) M1K probably null Het
Flna A T X: 73,279,273 (GRCm39) V1253E probably damaging Het
Fryl A T 5: 73,269,766 (GRCm39) S396R probably damaging Het
Gm12185 A T 11: 48,798,172 (GRCm39) C774S probably benign Het
Habp2 A G 19: 56,300,133 (GRCm39) Y194C probably damaging Het
Insyn2b A T 11: 34,369,739 (GRCm39) Q481L probably damaging Het
Irf5 A T 6: 29,536,781 (GRCm39) Q497H probably benign Het
Lama3 A T 18: 12,713,398 (GRCm39) K3230M probably damaging Het
Lins1 C T 7: 66,357,946 (GRCm39) T27I probably benign Het
Ncstn A C 1: 171,897,576 (GRCm39) V439G probably damaging Het
Nlrx1 A T 9: 44,166,722 (GRCm39) probably benign Het
Nol8 A T 13: 49,813,492 (GRCm39) K162* probably null Het
Or7g21 A G 9: 19,032,956 (GRCm39) E232G probably benign Het
Or8b54 A G 9: 38,686,664 (GRCm39) T38A probably benign Het
Pabpc5 A G X: 118,838,321 (GRCm39) E212G probably benign Het
Pecr G A 1: 72,315,468 (GRCm39) T94I probably damaging Het
Piezo2 A T 18: 63,144,767 (GRCm39) V2776E probably damaging Het
Pik3r2 G A 8: 71,223,065 (GRCm39) R452C probably benign Het
Pole3 G T 4: 62,443,198 (GRCm39) N12K possibly damaging Het
Prl2a1 A G 13: 27,990,263 (GRCm39) S71G probably benign Het
Rab39 G A 9: 53,597,932 (GRCm39) A111V possibly damaging Het
Rb1cc1 T A 1: 6,318,494 (GRCm39) probably benign Het
Shroom3 T C 5: 93,088,738 (GRCm39) V496A probably benign Het
Slc26a1 A G 5: 108,821,818 (GRCm39) S24P probably benign Het
Tspoap1 A T 11: 87,653,272 (GRCm39) N113Y probably damaging Het
Usp17lc A T 7: 103,067,626 (GRCm39) H307L probably damaging Het
Vmn2r79 T C 7: 86,652,801 (GRCm39) W498R probably damaging Het
Vmn2r94 C A 17: 18,478,647 (GRCm39) Q33H possibly damaging Het
Wwc2 T C 8: 48,309,358 (GRCm39) D808G unknown Het
Ybx2 G A 11: 69,831,242 (GRCm39) R84Q probably damaging Het
Zfp462 C T 4: 55,012,402 (GRCm39) S308F probably damaging Het
Other mutations in E2f1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0666:E2f1 UTSW 2 154,402,849 (GRCm39) missense probably benign 0.01
R0674:E2f1 UTSW 2 154,406,029 (GRCm39) missense probably damaging 1.00
R1796:E2f1 UTSW 2 154,402,849 (GRCm39) missense probably benign 0.02
R3747:E2f1 UTSW 2 154,405,942 (GRCm39) missense probably damaging 1.00
R3751:E2f1 UTSW 2 154,405,942 (GRCm39) missense probably damaging 1.00
R3752:E2f1 UTSW 2 154,405,942 (GRCm39) missense probably damaging 1.00
R3753:E2f1 UTSW 2 154,405,942 (GRCm39) missense probably damaging 1.00
R3843:E2f1 UTSW 2 154,402,748 (GRCm39) missense probably benign 0.00
R3844:E2f1 UTSW 2 154,402,748 (GRCm39) missense probably benign 0.00
R3968:E2f1 UTSW 2 154,405,942 (GRCm39) missense probably damaging 1.00
R3970:E2f1 UTSW 2 154,405,942 (GRCm39) missense probably damaging 1.00
R4409:E2f1 UTSW 2 154,405,942 (GRCm39) missense probably damaging 1.00
R4700:E2f1 UTSW 2 154,405,942 (GRCm39) missense probably damaging 1.00
R5396:E2f1 UTSW 2 154,406,368 (GRCm39) missense probably benign 0.00
R5666:E2f1 UTSW 2 154,411,101 (GRCm39) intron probably benign
R6368:E2f1 UTSW 2 154,406,396 (GRCm39) missense possibly damaging 0.81
R9348:E2f1 UTSW 2 154,402,755 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TAAGACCTTGGTTTCCCAGCTG -3'
(R):5'- TACATTGCTAGGGAGACAGGC -3'

Sequencing Primer
(F):5'- GCCACTGCAAGCAATTTGG -3'
(R):5'- CTAGGGAGACAGGCCTGTTG -3'
Posted On 2015-04-29