Incidental Mutation 'R3969:Usp17lc'
ID310877
Institutional Source Beutler Lab
Gene Symbol Usp17lc
Ensembl Gene ENSMUSG00000058976
Gene Nameubiquitin specific peptidase 17-like C
SynonymsDub2, Usp17l5, Dub2b, Dub-2
MMRRC Submission 040937-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3969 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location103415072-103419880 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 103418419 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 307 (H307L)
Ref Sequence ENSEMBL: ENSMUSP00000102505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079348] [ENSMUST00000106892]
Predicted Effect probably damaging
Transcript: ENSMUST00000079348
AA Change: H307L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000078323
Gene: ENSMUSG00000058976
AA Change: H307L

DomainStartEndE-ValueType
Pfam:UCH 50 345 3.8e-54 PFAM
Pfam:UCH_1 51 327 3.5e-25 PFAM
low complexity region 374 385 N/A INTRINSIC
low complexity region 529 539 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106892
AA Change: H307L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102505
Gene: ENSMUSG00000058976
AA Change: H307L

DomainStartEndE-ValueType
Pfam:UCH 50 345 1.3e-60 PFAM
Pfam:UCH_1 51 327 5.5e-30 PFAM
low complexity region 374 385 N/A INTRINSIC
low complexity region 529 539 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000116717
Meta Mutation Damage Score 0.8553 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 100% (48/48)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic elthality before implantation, failure to hatch from the zona pellucida, decreased cell proliferation and increased apoptosis. Mice heterozygous for this allele exhibit abnormal body, testis and thymus weight and reduced sperm motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahi1 A G 10: 20,959,947 K60E probably damaging Het
Arhgef12 C A 9: 43,005,551 R432L probably damaging Het
Armcx6 G T X: 134,749,756 H109N possibly damaging Het
Camk2d G T 3: 126,796,959 C273F possibly damaging Het
Camk4 T A 18: 33,179,581 I258N possibly damaging Het
Chia1 T G 3: 106,121,635 probably null Het
Commd9 C A 2: 101,897,141 N93K probably benign Het
Cpeb4 T C 11: 31,872,811 I175T possibly damaging Het
Dnah17 G A 11: 118,041,158 probably benign Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Faap100 A T 11: 120,378,705 M1K probably null Het
Fam196b A T 11: 34,419,739 Q481L probably damaging Het
Flna A T X: 74,235,667 V1253E probably damaging Het
Fryl A T 5: 73,112,423 S396R probably damaging Het
Gm12185 A T 11: 48,907,345 C774S probably benign Het
Habp2 A G 19: 56,311,701 Y194C probably damaging Het
Irf5 A T 6: 29,536,782 Q497H probably benign Het
Lama3 A T 18: 12,580,341 K3230M probably damaging Het
Lins1 C T 7: 66,708,198 T27I probably benign Het
Ncstn A C 1: 172,070,009 V439G probably damaging Het
Nlrx1 A T 9: 44,255,425 probably benign Het
Nol8 A T 13: 49,660,016 K162* probably null Het
Olfr836 A G 9: 19,121,660 E232G probably benign Het
Olfr921 A G 9: 38,775,368 T38A probably benign Het
Pabpc5 A G X: 119,928,624 E212G probably benign Het
Pecr G A 1: 72,276,309 T94I probably damaging Het
Piezo2 A T 18: 63,011,696 V2776E probably damaging Het
Pik3r2 G A 8: 70,770,421 R452C probably benign Het
Pole3 G T 4: 62,524,961 N12K possibly damaging Het
Prl2a1 A G 13: 27,806,280 S71G probably benign Het
Rab39 G A 9: 53,686,632 A111V possibly damaging Het
Rb1cc1 T A 1: 6,248,270 probably benign Het
Shroom3 T C 5: 92,940,879 V496A probably benign Het
Slc26a1 A G 5: 108,673,952 S24P probably benign Het
Tspoap1 A T 11: 87,762,446 N113Y probably damaging Het
Vmn2r79 T C 7: 87,003,593 W498R probably damaging Het
Vmn2r94 C A 17: 18,258,385 Q33H possibly damaging Het
Wwc2 T C 8: 47,856,323 D808G unknown Het
Ybx2 G A 11: 69,940,416 R84Q probably damaging Het
Zfp462 C T 4: 55,012,402 S308F probably damaging Het
Other mutations in Usp17lc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Usp17lc APN 7 103418941 missense possibly damaging 0.74
IGL00499:Usp17lc APN 7 103418466 missense probably damaging 1.00
IGL00499:Usp17lc APN 7 103418465 missense probably damaging 1.00
IGL01446:Usp17lc APN 7 103418444 missense probably benign 0.00
R1466:Usp17lc UTSW 7 103418941 missense possibly damaging 0.74
R1466:Usp17lc UTSW 7 103418941 missense possibly damaging 0.74
R1584:Usp17lc UTSW 7 103418941 missense possibly damaging 0.74
R1754:Usp17lc UTSW 7 103418848 missense probably benign 0.01
R2987:Usp17lc UTSW 7 103418302 missense probably damaging 0.99
R4661:Usp17lc UTSW 7 103418590 missense probably benign 0.00
R5118:Usp17lc UTSW 7 103418661 missense probably benign 0.05
R5413:Usp17lc UTSW 7 103418556 missense probably benign
R6962:Usp17lc UTSW 7 103418911 missense probably benign 0.00
R7412:Usp17lc UTSW 7 103418368 missense probably damaging 1.00
R7638:Usp17lc UTSW 7 103418499 missense probably damaging 1.00
R7748:Usp17lc UTSW 7 103418481 missense probably damaging 1.00
R8194:Usp17lc UTSW 7 103418200 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGATGCCAGCTTCCAAGAC -3'
(R):5'- GAACCTCATGTACTCTGCCC -3'

Sequencing Primer
(F):5'- CCAAAGGTACTCCTGCTAGTG -3'
(R):5'- CCCTCTGGCATGTCAATACTG -3'
Posted On2015-04-29