Incidental Mutation 'R3970:Tlk1'
ID310907
Institutional Source Beutler Lab
Gene Symbol Tlk1
Ensembl Gene ENSMUSG00000041997
Gene Nametousled-like kinase 1
Synonyms4930545J15Rik
MMRRC Submission 040938-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3970 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location70712407-70825728 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70716652 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 695 (V695A)
Ref Sequence ENSEMBL: ENSMUSP00000035961 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038584] [ENSMUST00000133432]
Predicted Effect probably damaging
Transcript: ENSMUST00000038584
AA Change: V695A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000035961
Gene: ENSMUSG00000041997
AA Change: V695A

DomainStartEndE-ValueType
low complexity region 20 33 N/A INTRINSIC
low complexity region 68 85 N/A INTRINSIC
low complexity region 170 192 N/A INTRINSIC
coiled coil region 248 277 N/A INTRINSIC
coiled coil region 403 441 N/A INTRINSIC
S_TKc 456 734 4.41e-75 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133432
SMART Domains Protein: ENSMUSP00000121549
Gene: ENSMUSG00000014959

DomainStartEndE-ValueType
PDZ 5 75 8.14e-1 SMART
internal_repeat_1 107 196 1.1e-15 PROSPERO
low complexity region 236 252 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135128
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141707
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152738
Meta Mutation Damage Score 0.7433 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine/threonine kinase that may be involved in the regulation of chromatin assembly. The encoded protein is only active when it is phosphorylated, and this phosphorylation is cell cycle-dependent, with the maximal activity of this protein coming during S phase. The catalytic activity of this protein is diminished by DNA damage and by blockage of DNA replication. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik T C 4: 147,945,322 M583T probably damaging Het
Actn4 T C 7: 28,962,032 K51R probably benign Het
Adamts15 T C 9: 30,910,602 Y513C probably benign Het
Akap13 T A 7: 75,569,951 L34* probably null Het
Akap6 A T 12: 53,141,453 K1883N probably damaging Het
Ano1 T C 7: 144,607,963 N749D probably benign Het
Armcx6 G T X: 134,749,756 H109N possibly damaging Het
Camk4 T A 18: 33,179,581 I258N possibly damaging Het
Cdhr2 A T 13: 54,726,458 N781I probably damaging Het
Cherp T C 8: 72,469,951 H196R possibly damaging Het
Chia1 T G 3: 106,121,635 probably null Het
Col11a1 A T 3: 114,097,189 T392S unknown Het
Commd9 C A 2: 101,897,141 N93K probably benign Het
Csf2rb T C 15: 78,341,467 V286A probably benign Het
Dnah17 G A 11: 118,041,158 probably benign Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Fam196b A T 11: 34,419,739 Q481L probably damaging Het
Fcho2 A T 13: 98,735,056 S551T probably benign Het
Flna A T X: 74,235,667 V1253E probably damaging Het
Gm12185 A T 11: 48,907,345 C774S probably benign Het
Gm14401 T C 2: 177,086,996 Y292H possibly damaging Het
Kif5c A G 2: 49,688,744 E128G probably damaging Het
Lama3 A T 18: 12,580,341 K3230M probably damaging Het
Myof C T 19: 37,901,263 V1287M probably damaging Het
Myof T G 19: 38,022,610 D60A possibly damaging Het
Myrf A G 19: 10,223,237 L332P probably damaging Het
Nampt T A 12: 32,833,096 D93E probably benign Het
Narf A T 11: 121,238,421 E10D possibly damaging Het
Nlrp6 C A 7: 140,921,655 A45E probably damaging Het
Obscn G A 11: 59,051,662 P4898L probably damaging Het
Olfr251 T C 9: 38,377,926 V15A probably damaging Het
Pabpc5 A G X: 119,928,624 E212G probably benign Het
Pcdh8 C T 14: 79,770,266 G286S possibly damaging Het
Pcdha2 C A 18: 36,940,697 Y460* probably null Het
Pcdhga4 G T 18: 37,687,601 L734F possibly damaging Het
Pecr G A 1: 72,276,309 T94I probably damaging Het
Piezo2 A T 18: 63,011,696 V2776E probably damaging Het
Pign A C 1: 105,656,003 S125A probably damaging Het
Pik3r2 G A 8: 70,770,421 R452C probably benign Het
Pkd1l1 C T 11: 8,874,218 E1566K probably damaging Het
Plcb2 A G 2: 118,715,690 probably benign Het
Ppl T C 16: 5,100,332 probably null Het
Pramel4 A T 4: 144,068,474 N477I possibly damaging Het
Psd C T 19: 46,324,406 R175H probably benign Het
Sema3g T C 14: 31,226,521 probably null Het
Sf3b1 G A 1: 55,012,182 R196* probably null Het
Slc26a4 G T 12: 31,528,687 H656N probably damaging Het
Slc6a7 A C 18: 61,003,345 L328R possibly damaging Het
Stab2 T C 10: 86,878,886 T139A probably damaging Het
Tiam2 T A 17: 3,428,831 I613N probably damaging Het
Trpc2 A G 7: 102,084,324 D160G probably damaging Het
Uhrf2 T C 19: 30,079,915 V491A probably damaging Het
Vwa7 G A 17: 35,017,708 A84T probably damaging Het
Zfp219 T A 14: 52,006,964 Q541L probably benign Het
Other mutations in Tlk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00673:Tlk1 APN 2 70745516 missense probably damaging 1.00
IGL01087:Tlk1 APN 2 70752316 missense possibly damaging 0.64
IGL01514:Tlk1 APN 2 70752266 missense probably benign 0.00
IGL02976:Tlk1 APN 2 70721591 nonsense probably null
IGL03024:Tlk1 APN 2 70746036 nonsense probably null
Aku-aku UTSW 2 70738445 missense probably damaging 0.98
Heyerdahl UTSW 2 70738426 nonsense probably null
K3955:Tlk1 UTSW 2 70721701 missense possibly damaging 0.85
R0107:Tlk1 UTSW 2 70713989 makesense probably null
R0226:Tlk1 UTSW 2 70714169 unclassified probably benign
R0332:Tlk1 UTSW 2 70745565 synonymous probably null
R0601:Tlk1 UTSW 2 70714158 missense probably benign 0.44
R1739:Tlk1 UTSW 2 70721077 missense probably damaging 1.00
R2080:Tlk1 UTSW 2 70738445 missense probably damaging 0.98
R2422:Tlk1 UTSW 2 70770005 missense probably damaging 1.00
R3843:Tlk1 UTSW 2 70749327 missense probably benign 0.05
R4191:Tlk1 UTSW 2 70725547 missense probably damaging 1.00
R4867:Tlk1 UTSW 2 70721571 nonsense probably null
R5022:Tlk1 UTSW 2 70742065 missense probably benign 0.10
R5275:Tlk1 UTSW 2 70752205 intron probably benign
R5469:Tlk1 UTSW 2 70721668 missense probably benign 0.15
R6531:Tlk1 UTSW 2 70742083 missense probably benign 0.00
R6592:Tlk1 UTSW 2 70714153 missense probably damaging 1.00
R6797:Tlk1 UTSW 2 70738426 nonsense probably null
R7030:Tlk1 UTSW 2 70721928 missense probably damaging 1.00
R7705:Tlk1 UTSW 2 70786672 intron probably null
R7970:Tlk1 UTSW 2 70752300 missense possibly damaging 0.64
R8284:Tlk1 UTSW 2 70714021 missense probably benign
X0028:Tlk1 UTSW 2 70746031 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAAAATCAAGTGGCTGTGC -3'
(R):5'- AGCTTTCAAGTAGCTGAGGACAG -3'

Sequencing Primer
(F):5'- TCAAAATCAAGTGGCTGTGCTTAGAG -3'
(R):5'- TAGCTGAGGACAGGATGTTAAAATAC -3'
Posted On2015-04-29