Mutagenetix > Incidental Mutations

Incidental Mutation 'R3970:Plcb2'

310909

Institutional Source

Beutler Lab

Gene Symbol

Plcb2

Ensembl Gene

ENSMUSG00000040061

Gene Name

phospholipase C, beta 2

Synonyms

B230205M18Rik

MMRRC Submission

040938-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3970 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

118707517-118728438 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to G at 118715690 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000124364 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102524] [ENSMUST00000159756]

AlphaFold

A3KGF7

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000006415

Predicted Effect

probably benign
Transcript: ENSMUST00000102524

SMART Domains

Protein: ENSMUSP00000099583
Gene: ENSMUSG00000040061

Domain	Start	End	E-Value	Type
low complexity region	3	13	N/A	INTRINSIC
Pfam:EF-hand_like	220	311	2.5e-24	PFAM
PLCXc	312	463	2.87e-79	SMART
low complexity region	504	518	N/A	INTRINSIC
PLCYc	547	663	2.39e-67	SMART
C2	684	783	9.17e-15	SMART
low complexity region	902	925	N/A	INTRINSIC
low complexity region	929	940	N/A	INTRINSIC
Pfam:PLC-beta_C	974	1149	4.7e-72	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127248

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129153

Predicted Effect

probably benign
Transcript: ENSMUST00000159756

SMART Domains

Protein: ENSMUSP00000124364
Gene: ENSMUSG00000040061

Domain	Start	End	E-Value	Type
low complexity region	3	13	N/A	INTRINSIC
Pfam:EF-hand_like	197	288	7.1e-26	PFAM
PLCXc	289	440	2.87e-79	SMART
low complexity region	481	495	N/A	INTRINSIC
PLCYc	524	640	2.39e-67	SMART
C2	661	760	9.17e-15	SMART
low complexity region	879	902	N/A	INTRINSIC
low complexity region	906	917	N/A	INTRINSIC
Pfam:PLC-beta_C	946	1129	5.1e-68	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.4%

Validation Efficiency

96% (53/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a phosphodiesterase that catalyzes the hydrolysis of phosphatidylinositol 4,5-bisphosphate to the second messengers inositol 1,4,5-trisphosphate (IP3) and diacylglycerol. The encoded protein is activated by G proteins and has been shown to be involved in the type 2 taste receptor signal transduction pathway. In addition, nuclear factor kappa B can regulate the transcription of this gene, whose protein product is also an important regulator of platelet responses. [provided by RefSeq, Jan 2017]
PHENOTYPE: Homozygous mutant mice showed an increased sensitivity to both bacterial and viral infections and exhibited abnormal taste perception in which sweet, umami, and bitter stimuli could not be sensed. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2510039O18Rik	T	C	4: 147,945,322	M583T	probably damaging	Het
Actn4	T	C	7: 28,962,032	K51R	probably benign	Het
Adamts15	T	C	9: 30,910,602	Y513C	probably benign	Het
Akap13	T	A	7: 75,569,951	L34*	probably null	Het
Akap6	A	T	12: 53,141,453	K1883N	probably damaging	Het
Ano1	T	C	7: 144,607,963	N749D	probably benign	Het
Armcx6	G	T	X: 134,749,756	H109N	possibly damaging	Het
Camk4	T	A	18: 33,179,581	I258N	possibly damaging	Het
Cdhr2	A	T	13: 54,726,458	N781I	probably damaging	Het
Cherp	T	C	8: 72,469,951	H196R	possibly damaging	Het
Chia1	T	G	3: 106,121,635		probably null	Het
Col11a1	A	T	3: 114,097,189	T392S	unknown	Het
Commd9	C	A	2: 101,897,141	N93K	probably benign	Het
Csf2rb	T	C	15: 78,341,467	V286A	probably benign	Het
Dnah17	G	A	11: 118,041,158		probably benign	Het
E2f1	C	G	2: 154,564,022	G144R	probably damaging	Het
Fam196b	A	T	11: 34,419,739	Q481L	probably damaging	Het
Fcho2	A	T	13: 98,735,056	S551T	probably benign	Het
Flna	A	T	X: 74,235,667	V1253E	probably damaging	Het
Gm12185	A	T	11: 48,907,345	C774S	probably benign	Het
Gm14401	T	C	2: 177,086,996	Y292H	possibly damaging	Het
Kif5c	A	G	2: 49,688,744	E128G	probably damaging	Het
Lama3	A	T	18: 12,580,341	K3230M	probably damaging	Het
Myof	C	T	19: 37,901,263	V1287M	probably damaging	Het
Myof	T	G	19: 38,022,610	D60A	possibly damaging	Het
Myrf	A	G	19: 10,223,237	L332P	probably damaging	Het
Nampt	T	A	12: 32,833,096	D93E	probably benign	Het
Narf	A	T	11: 121,238,421	E10D	possibly damaging	Het
Nlrp6	C	A	7: 140,921,655	A45E	probably damaging	Het
Obscn	G	A	11: 59,051,662	P4898L	probably damaging	Het
Olfr251	T	C	9: 38,377,926	V15A	probably damaging	Het
Pabpc5	A	G	X: 119,928,624	E212G	probably benign	Het
Pcdh8	C	T	14: 79,770,266	G286S	possibly damaging	Het
Pcdha2	C	A	18: 36,940,697	Y460*	probably null	Het
Pcdhga4	G	T	18: 37,687,601	L734F	possibly damaging	Het
Pecr	G	A	1: 72,276,309	T94I	probably damaging	Het
Piezo2	A	T	18: 63,011,696	V2776E	probably damaging	Het
Pign	A	C	1: 105,656,003	S125A	probably damaging	Het
Pik3r2	G	A	8: 70,770,421	R452C	probably benign	Het
Pkd1l1	C	T	11: 8,874,218	E1566K	probably damaging	Het
Ppl	T	C	16: 5,100,332		probably null	Het
Pramel4	A	T	4: 144,068,474	N477I	possibly damaging	Het
Psd	C	T	19: 46,324,406	R175H	probably benign	Het
Sema3g	T	C	14: 31,226,521		probably null	Het
Sf3b1	G	A	1: 55,012,182	R196*	probably null	Het
Slc26a4	G	T	12: 31,528,687	H656N	probably damaging	Het
Slc6a7	A	C	18: 61,003,345	L328R	possibly damaging	Het
Stab2	T	C	10: 86,878,886	T139A	probably damaging	Het
Tiam2	T	A	17: 3,428,831	I613N	probably damaging	Het
Tlk1	A	G	2: 70,716,652	V695A	probably damaging	Het
Trpc2	A	G	7: 102,084,324	D160G	probably damaging	Het
Uhrf2	T	C	19: 30,079,915	V491A	probably damaging	Het
Vwa7	G	A	17: 35,017,708	A84T	probably damaging	Het
Zfp219	T	A	14: 52,006,964	Q541L	probably benign	Het

Other mutations in Plcb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00580:Plcb2	APN	2	118718889	missense	probably damaging	1.00
IGL00715:Plcb2	APN	2	118713734	critical splice donor site	probably null
IGL00851:Plcb2	APN	2	118728251	missense	probably benign	0.30
IGL01765:Plcb2	APN	2	118710268	splice site	probably benign
IGL01837:Plcb2	APN	2	118711926	splice site	probably null
IGL01868:Plcb2	APN	2	118709590	missense	probably damaging	1.00
IGL01868:Plcb2	APN	2	118711387	missense	probably benign	0.09
IGL02158:Plcb2	APN	2	118711363	missense	probably benign	0.06
IGL02447:Plcb2	APN	2	118713155	missense	probably damaging	1.00
IGL02490:Plcb2	APN	2	118719760	missense	probably damaging	0.99
IGL02691:Plcb2	APN	2	118710963	missense	probably benign	0.00
IGL02723:Plcb2	APN	2	118717019	splice site	probably benign
IGL02929:Plcb2	APN	2	118713234	splice site	probably benign
IGL02949:Plcb2	APN	2	118719109	splice site	probably null
PIT4480001:Plcb2	UTSW	2	118723496	missense	probably benign	0.00
R0031:Plcb2	UTSW	2	118715461	missense	probably benign	0.36
R0157:Plcb2	UTSW	2	118718541	missense	probably damaging	0.98
R0366:Plcb2	UTSW	2	118724447	missense	probably benign	0.01
R0376:Plcb2	UTSW	2	118717240	missense	probably damaging	0.99
R0570:Plcb2	UTSW	2	118717325	missense	probably benign	0.32
R0790:Plcb2	UTSW	2	118712483	splice site	probably benign
R0893:Plcb2	UTSW	2	118725105	splice site	probably benign
R1647:Plcb2	UTSW	2	118723780	missense	possibly damaging	0.51
R1648:Plcb2	UTSW	2	118723780	missense	possibly damaging	0.51
R1686:Plcb2	UTSW	2	118715687	splice site	probably benign
R2210:Plcb2	UTSW	2	118717503	missense	probably damaging	1.00
R2211:Plcb2	UTSW	2	118723534	missense	probably benign	0.05
R2251:Plcb2	UTSW	2	118723765	missense	probably benign	0.10
R2252:Plcb2	UTSW	2	118723765	missense	probably benign	0.10
R2253:Plcb2	UTSW	2	118723765	missense	probably benign	0.10
R2426:Plcb2	UTSW	2	118715649	missense	probably damaging	1.00
R4007:Plcb2	UTSW	2	118710793	missense	probably damaging	1.00
R4162:Plcb2	UTSW	2	118709587	missense	probably damaging	1.00
R4236:Plcb2	UTSW	2	118709566	missense	probably damaging	1.00
R4422:Plcb2	UTSW	2	118712003	missense	probably benign	0.28
R4772:Plcb2	UTSW	2	118713134	missense	probably benign	0.20
R4795:Plcb2	UTSW	2	118711124	missense	probably benign	0.32
R4935:Plcb2	UTSW	2	118718915	missense	probably damaging	1.00
R5019:Plcb2	UTSW	2	118712136	missense	probably benign	0.01
R5055:Plcb2	UTSW	2	118718222	missense	probably benign	0.06
R5452:Plcb2	UTSW	2	118718246	missense	probably damaging	0.98
R5622:Plcb2	UTSW	2	118714729	missense	probably damaging	1.00
R5752:Plcb2	UTSW	2	118711051	intron	probably benign
R6284:Plcb2	UTSW	2	118717301	missense	probably benign	0.37
R6380:Plcb2	UTSW	2	118715468	missense	probably damaging	1.00
R6574:Plcb2	UTSW	2	118719173	missense	probably damaging	0.99
R6728:Plcb2	UTSW	2	118723690	missense	probably damaging	1.00
R6792:Plcb2	UTSW	2	118719441	missense	probably damaging	1.00
R7529:Plcb2	UTSW	2	118710234	missense	probably damaging	1.00
R7560:Plcb2	UTSW	2	118715643	missense	probably damaging	0.99
R7610:Plcb2	UTSW	2	118719759	missense	possibly damaging	0.86
R7760:Plcb2	UTSW	2	118711388	missense	probably benign
R8152:Plcb2	UTSW	2	118710821	missense	probably benign	0.22
R8170:Plcb2	UTSW	2	118711453	missense	possibly damaging	0.68
R8413:Plcb2	UTSW	2	118718823	missense	probably damaging	1.00
R8913:Plcb2	UTSW	2	118713884	missense	probably damaging	1.00
X0024:Plcb2	UTSW	2	118712375	missense	probably benign	0.13
Z1176:Plcb2	UTSW	2	118723128	missense	probably damaging	0.99
Z1177:Plcb2	UTSW	2	118709200	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AGCTGTCGCTGAGTATAGGAGC -3'
(R):5'- TGCATGTCCACAGTGATGTCC -3'

Sequencing Primer
(F):5'- GCTGAGTATAGGAGCTGGCC -3'
(R):5'- ACAGTGATGTCCCTTTACCCCAG -3'

Posted On

2015-04-29