Incidental Mutation 'R3970:Nlrp6'
ID310919
Institutional Source Beutler Lab
Gene Symbol Nlrp6
Ensembl Gene ENSMUSG00000038745
Gene NameNLR family, pyrin domain containing 6
SynonymsNalp6
MMRRC Submission 040938-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R3970 (G1)
Quality Score108
Status Validated
Chromosome7
Chromosomal Location140920902-140929192 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 140921655 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 45 (A45E)
Ref Sequence ENSEMBL: ENSMUSP00000139170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106045] [ENSMUST00000183845] [ENSMUST00000184560]
Predicted Effect probably damaging
Transcript: ENSMUST00000106045
AA Change: A15E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101660
Gene: ENSMUSG00000038745
AA Change: A15E

DomainStartEndE-ValueType
PYRIN 15 96 5.44e-27 SMART
low complexity region 158 169 N/A INTRINSIC
Pfam:NACHT 194 363 8.6e-44 PFAM
coiled coil region 590 617 N/A INTRINSIC
low complexity region 675 697 N/A INTRINSIC
internal_repeat_1 715 763 9.43e-6 PROSPERO
internal_repeat_1 828 876 9.43e-6 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183761
Predicted Effect probably damaging
Transcript: ENSMUST00000183845
AA Change: A15E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139357
Gene: ENSMUSG00000038745
AA Change: A15E

DomainStartEndE-ValueType
PYRIN 15 96 5.44e-27 SMART
low complexity region 158 169 N/A INTRINSIC
Pfam:NACHT 194 363 5.5e-43 PFAM
coiled coil region 590 617 N/A INTRINSIC
low complexity region 680 694 N/A INTRINSIC
internal_repeat_1 702 750 1.26e-5 PROSPERO
internal_repeat_1 815 863 1.26e-5 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000184560
AA Change: A45E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139170
Gene: ENSMUSG00000038745
AA Change: A45E

DomainStartEndE-ValueType
PYRIN 45 126 5.44e-27 SMART
low complexity region 188 199 N/A INTRINSIC
Pfam:NACHT 224 393 8.2e-43 PFAM
coiled coil region 620 647 N/A INTRINSIC
low complexity region 710 724 N/A INTRINSIC
internal_repeat_1 732 780 1.55e-5 PROSPERO
internal_repeat_1 845 893 1.55e-5 PROSPERO
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: The protein encoded by this gene binds arginine-vasopressin and may be involved in the arginine-vasopressin-mediated regulation of renal salt-water balance. The encoded protein also mediates inflammatory responses in the colon to allow recovery from intestinal epithelial damage and protects against tumorigenesis and the development of colitis. Finally, this protein can increase activation of NF-kappa-B, activation of CASP1 through interaction with ASC, and cAMP accumulation. [provided by RefSeq, Feb 2013]
PHENOTYPE: Nullizygous mutations lead to altered colonic microbiota, increased susceptibility to induced colitis and/or inflammation-associated colon tumorigenesis. Homozygotes for a null allele show lower blood pressure and sex-specific changes in urine concentrating ability, cognition, and anxiety behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik T C 4: 147,945,322 M583T probably damaging Het
Actn4 T C 7: 28,962,032 K51R probably benign Het
Adamts15 T C 9: 30,910,602 Y513C probably benign Het
Akap13 T A 7: 75,569,951 L34* probably null Het
Akap6 A T 12: 53,141,453 K1883N probably damaging Het
Ano1 T C 7: 144,607,963 N749D probably benign Het
Armcx6 G T X: 134,749,756 H109N possibly damaging Het
Camk4 T A 18: 33,179,581 I258N possibly damaging Het
Cdhr2 A T 13: 54,726,458 N781I probably damaging Het
Cherp T C 8: 72,469,951 H196R possibly damaging Het
Chia1 T G 3: 106,121,635 probably null Het
Col11a1 A T 3: 114,097,189 T392S unknown Het
Commd9 C A 2: 101,897,141 N93K probably benign Het
Csf2rb T C 15: 78,341,467 V286A probably benign Het
Dnah17 G A 11: 118,041,158 probably benign Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Fam196b A T 11: 34,419,739 Q481L probably damaging Het
Fcho2 A T 13: 98,735,056 S551T probably benign Het
Flna A T X: 74,235,667 V1253E probably damaging Het
Gm12185 A T 11: 48,907,345 C774S probably benign Het
Gm14401 T C 2: 177,086,996 Y292H possibly damaging Het
Kif5c A G 2: 49,688,744 E128G probably damaging Het
Lama3 A T 18: 12,580,341 K3230M probably damaging Het
Myof C T 19: 37,901,263 V1287M probably damaging Het
Myof T G 19: 38,022,610 D60A possibly damaging Het
Myrf A G 19: 10,223,237 L332P probably damaging Het
Nampt T A 12: 32,833,096 D93E probably benign Het
Narf A T 11: 121,238,421 E10D possibly damaging Het
Obscn G A 11: 59,051,662 P4898L probably damaging Het
Olfr251 T C 9: 38,377,926 V15A probably damaging Het
Pabpc5 A G X: 119,928,624 E212G probably benign Het
Pcdh8 C T 14: 79,770,266 G286S possibly damaging Het
Pcdha2 C A 18: 36,940,697 Y460* probably null Het
Pcdhga4 G T 18: 37,687,601 L734F possibly damaging Het
Pecr G A 1: 72,276,309 T94I probably damaging Het
Piezo2 A T 18: 63,011,696 V2776E probably damaging Het
Pign A C 1: 105,656,003 S125A probably damaging Het
Pik3r2 G A 8: 70,770,421 R452C probably benign Het
Pkd1l1 C T 11: 8,874,218 E1566K probably damaging Het
Plcb2 A G 2: 118,715,690 probably benign Het
Ppl T C 16: 5,100,332 probably null Het
Pramel4 A T 4: 144,068,474 N477I possibly damaging Het
Psd C T 19: 46,324,406 R175H probably benign Het
Sema3g T C 14: 31,226,521 probably null Het
Sf3b1 G A 1: 55,012,182 R196* probably null Het
Slc26a4 G T 12: 31,528,687 H656N probably damaging Het
Slc6a7 A C 18: 61,003,345 L328R possibly damaging Het
Stab2 T C 10: 86,878,886 T139A probably damaging Het
Tiam2 T A 17: 3,428,831 I613N probably damaging Het
Tlk1 A G 2: 70,716,652 V695A probably damaging Het
Trpc2 A G 7: 102,084,324 D160G probably damaging Het
Uhrf2 T C 19: 30,079,915 V491A probably damaging Het
Vwa7 G A 17: 35,017,708 A84T probably damaging Het
Zfp219 T A 14: 52,006,964 Q541L probably benign Het
Other mutations in Nlrp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Nlrp6 APN 7 140923124 missense probably damaging 1.00
IGL01066:Nlrp6 APN 7 140921796 missense possibly damaging 0.88
IGL01966:Nlrp6 APN 7 140925190 missense probably damaging 1.00
IGL02625:Nlrp6 APN 7 140923500 missense probably benign 0.00
IGL02792:Nlrp6 APN 7 140922435 missense probably damaging 0.97
IGL02813:Nlrp6 APN 7 140923420 missense possibly damaging 0.86
IGL03140:Nlrp6 APN 7 140927487 missense probably benign 0.01
R0608:Nlrp6 UTSW 7 140923486 nonsense probably null
R1404:Nlrp6 UTSW 7 140924113 small deletion probably benign
R1404:Nlrp6 UTSW 7 140924113 small deletion probably benign
R1472:Nlrp6 UTSW 7 140923495 missense probably damaging 1.00
R1587:Nlrp6 UTSW 7 140923046 missense probably damaging 1.00
R1843:Nlrp6 UTSW 7 140923093 missense probably damaging 1.00
R1959:Nlrp6 UTSW 7 140924113 small deletion probably benign
R2097:Nlrp6 UTSW 7 140923204 missense probably damaging 1.00
R2118:Nlrp6 UTSW 7 140926444 missense probably benign 0.11
R2119:Nlrp6 UTSW 7 140926444 missense probably benign 0.11
R2120:Nlrp6 UTSW 7 140926444 missense probably benign 0.11
R2121:Nlrp6 UTSW 7 140926444 missense probably benign 0.11
R2290:Nlrp6 UTSW 7 140922163 missense probably damaging 1.00
R3546:Nlrp6 UTSW 7 140926769 missense probably benign 0.00
R3547:Nlrp6 UTSW 7 140926769 missense probably benign 0.00
R4483:Nlrp6 UTSW 7 140921781 missense probably damaging 1.00
R4484:Nlrp6 UTSW 7 140921781 missense probably damaging 1.00
R4869:Nlrp6 UTSW 7 140924093 missense probably damaging 1.00
R4962:Nlrp6 UTSW 7 140923584 missense probably damaging 0.99
R5436:Nlrp6 UTSW 7 140922717 nonsense probably null
R5442:Nlrp6 UTSW 7 140922190 missense probably benign 0.01
R5924:Nlrp6 UTSW 7 140923490 missense probably damaging 1.00
R5936:Nlrp6 UTSW 7 140922812 nonsense probably null
R6124:Nlrp6 UTSW 7 140923247 missense probably damaging 1.00
R6455:Nlrp6 UTSW 7 140927509 missense possibly damaging 0.65
R6480:Nlrp6 UTSW 7 140927443 missense possibly damaging 0.93
R6873:Nlrp6 UTSW 7 140923520 missense probably benign 0.01
R7061:Nlrp6 UTSW 7 140922867 missense probably benign 0.36
R7350:Nlrp6 UTSW 7 140921278 start gained probably benign
R7532:Nlrp6 UTSW 7 140925184 missense probably benign 0.00
R7752:Nlrp6 UTSW 7 140927440 missense possibly damaging 0.92
R7901:Nlrp6 UTSW 7 140927440 missense possibly damaging 0.92
R8098:Nlrp6 UTSW 7 140923255 missense probably damaging 1.00
R8381:Nlrp6 UTSW 7 140923841 missense possibly damaging 0.47
R8513:Nlrp6 UTSW 7 140922830 missense possibly damaging 0.83
V7732:Nlrp6 UTSW 7 140926648 splice site probably benign
Z1176:Nlrp6 UTSW 7 140922721 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCATGGAGTGATCCACTTC -3'
(R):5'- CCGGGTCATTTCTACAGCTG -3'

Sequencing Primer
(F):5'- CACCACAGTCAGTAATTTGAGGTG -3'
(R):5'- TGGCACTGGCTCATAGAACTC -3'
Posted On2015-04-29