Mutagenetix > Incidental Mutations

Incidental Mutation 'R3970:Ano1'

310920

Institutional Source

Beutler Lab

Gene Symbol

Ano1

Ensembl Gene

ENSMUSG00000031075

Gene Name

anoctamin 1, calcium activated chloride channel

Synonyms

Tmem16a

MMRRC Submission

040938-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R3970 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

144588549-144751974 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 144607963 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 749 (N749D)

Ref Sequence

ENSEMBL: ENSMUSP00000112616 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033393] [ENSMUST00000118556] [ENSMUST00000121758]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000033393
AA Change: N688D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000033393
Gene: ENSMUSG00000031075
AA Change: N688D

Domain	Start	End	E-Value	Type
low complexity region	129	147	N/A	INTRINSIC
Pfam:Anoctamin	320	898	1.3e-149	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000118556
AA Change: N746D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000113899
Gene: ENSMUSG00000031075
AA Change: N746D

Domain	Start	End	E-Value	Type
Pfam:Anoct_dimer	112	375	5.5e-83	PFAM
Pfam:Anoctamin	378	955	6.7e-140	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000121758
AA Change: N749D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000112616
Gene: ENSMUSG00000031075
AA Change: N749D

Domain	Start	End	E-Value	Type
Pfam:Anoct_dimer	54	317	7.1e-83	PFAM
Pfam:Anoctamin	320	901	2.2e-139	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131571

Meta Mutation Damage Score

0.0717

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.4%

Validation Efficiency

96% (53/55)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knockout allele exhibit postnatal death associated with aerophagia, slow postnatal weight gain, cyanosis, and abnormal tracheal morphology. Mice homozygous for a different knock-out allele exhibit proteinuria and intracellular endosomal vesicles in PTE cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2510039O18Rik	T	C	4: 147,945,322	M583T	probably damaging	Het
Actn4	T	C	7: 28,962,032	K51R	probably benign	Het
Adamts15	T	C	9: 30,910,602	Y513C	probably benign	Het
Akap13	T	A	7: 75,569,951	L34*	probably null	Het
Akap6	A	T	12: 53,141,453	K1883N	probably damaging	Het
Armcx6	G	T	X: 134,749,756	H109N	possibly damaging	Het
Camk4	T	A	18: 33,179,581	I258N	possibly damaging	Het
Cdhr2	A	T	13: 54,726,458	N781I	probably damaging	Het
Cherp	T	C	8: 72,469,951	H196R	possibly damaging	Het
Chia1	T	G	3: 106,121,635		probably null	Het
Col11a1	A	T	3: 114,097,189	T392S	unknown	Het
Commd9	C	A	2: 101,897,141	N93K	probably benign	Het
Csf2rb	T	C	15: 78,341,467	V286A	probably benign	Het
Dnah17	G	A	11: 118,041,158		probably benign	Het
E2f1	C	G	2: 154,564,022	G144R	probably damaging	Het
Fam196b	A	T	11: 34,419,739	Q481L	probably damaging	Het
Fcho2	A	T	13: 98,735,056	S551T	probably benign	Het
Flna	A	T	X: 74,235,667	V1253E	probably damaging	Het
Gm12185	A	T	11: 48,907,345	C774S	probably benign	Het
Gm14401	T	C	2: 177,086,996	Y292H	possibly damaging	Het
Kif5c	A	G	2: 49,688,744	E128G	probably damaging	Het
Lama3	A	T	18: 12,580,341	K3230M	probably damaging	Het
Myof	C	T	19: 37,901,263	V1287M	probably damaging	Het
Myof	T	G	19: 38,022,610	D60A	possibly damaging	Het
Myrf	A	G	19: 10,223,237	L332P	probably damaging	Het
Nampt	T	A	12: 32,833,096	D93E	probably benign	Het
Narf	A	T	11: 121,238,421	E10D	possibly damaging	Het
Nlrp6	C	A	7: 140,921,655	A45E	probably damaging	Het
Obscn	G	A	11: 59,051,662	P4898L	probably damaging	Het
Olfr251	T	C	9: 38,377,926	V15A	probably damaging	Het
Pabpc5	A	G	X: 119,928,624	E212G	probably benign	Het
Pcdh8	C	T	14: 79,770,266	G286S	possibly damaging	Het
Pcdha2	C	A	18: 36,940,697	Y460*	probably null	Het
Pcdhga4	G	T	18: 37,687,601	L734F	possibly damaging	Het
Pecr	G	A	1: 72,276,309	T94I	probably damaging	Het
Piezo2	A	T	18: 63,011,696	V2776E	probably damaging	Het
Pign	A	C	1: 105,656,003	S125A	probably damaging	Het
Pik3r2	G	A	8: 70,770,421	R452C	probably benign	Het
Pkd1l1	C	T	11: 8,874,218	E1566K	probably damaging	Het
Plcb2	A	G	2: 118,715,690		probably benign	Het
Ppl	T	C	16: 5,100,332		probably null	Het
Pramel4	A	T	4: 144,068,474	N477I	possibly damaging	Het
Psd	C	T	19: 46,324,406	R175H	probably benign	Het
Sema3g	T	C	14: 31,226,521		probably null	Het
Sf3b1	G	A	1: 55,012,182	R196*	probably null	Het
Slc26a4	G	T	12: 31,528,687	H656N	probably damaging	Het
Slc6a7	A	C	18: 61,003,345	L328R	possibly damaging	Het
Stab2	T	C	10: 86,878,886	T139A	probably damaging	Het
Tiam2	T	A	17: 3,428,831	I613N	probably damaging	Het
Tlk1	A	G	2: 70,716,652	V695A	probably damaging	Het
Trpc2	A	G	7: 102,084,324	D160G	probably damaging	Het
Uhrf2	T	C	19: 30,079,915	V491A	probably damaging	Het
Vwa7	G	A	17: 35,017,708	A84T	probably damaging	Het
Zfp219	T	A	14: 52,006,964	Q541L	probably benign	Het

Other mutations in Ano1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00595:Ano1	APN	7	144638513	missense	probably damaging	1.00
IGL00754:Ano1	APN	7	144597231	missense	probably damaging	0.98
IGL00780:Ano1	APN	7	144655630	missense	probably damaging	0.99
IGL00918:Ano1	APN	7	144644752	splice site	probably benign
IGL01112:Ano1	APN	7	144637145	missense	possibly damaging	0.52
IGL01285:Ano1	APN	7	144644742	missense	probably benign	0.00
IGL01285:Ano1	APN	7	144595538	missense	probably damaging	0.98
IGL01308:Ano1	APN	7	144595498	missense	probably damaging	0.99
IGL01407:Ano1	APN	7	144637111	missense	probably benign	0.22
IGL01672:Ano1	APN	7	144655675	missense	probably damaging	0.96
IGL01920:Ano1	APN	7	144611454	splice site	probably benign
IGL01926:Ano1	APN	7	144610875	missense	possibly damaging	0.94
IGL02164:Ano1	APN	7	144637181	missense	possibly damaging	0.91
IGL02190:Ano1	APN	7	144618883	missense	probably benign	0.41
IGL02214:Ano1	APN	7	144655708	missense	possibly damaging	0.80
IGL02299:Ano1	APN	7	144590075	missense	possibly damaging	0.80
IGL02567:Ano1	APN	7	144611625	missense	probably damaging	1.00
IGL03131:Ano1	APN	7	144603585	missense	possibly damaging	0.90
IGL03291:Ano1	APN	7	144621675	missense	probably damaging	1.00
IGL03299:Ano1	APN	7	144654256	missense	probably damaging	1.00
IGL03394:Ano1	APN	7	144595439	splice site	probably null
PIT4434001:Ano1	UTSW	7	144610895	missense	probably benign	0.28
R0502:Ano1	UTSW	7	144597215	missense	probably damaging	1.00
R0595:Ano1	UTSW	7	144590153	missense	possibly damaging	0.94
R0732:Ano1	UTSW	7	144619488	critical splice acceptor site	probably null
R0970:Ano1	UTSW	7	144595571	missense	probably benign	0.02
R0988:Ano1	UTSW	7	144633653	missense	possibly damaging	0.94
R1074:Ano1	UTSW	7	144611680	missense	probably damaging	0.98
R1301:Ano1	UTSW	7	144633689	missense	possibly damaging	0.60
R1528:Ano1	UTSW	7	144595566	missense	probably damaging	1.00
R2018:Ano1	UTSW	7	144654250	missense	probably damaging	1.00
R2056:Ano1	UTSW	7	144648052	missense	probably damaging	1.00
R2057:Ano1	UTSW	7	144648052	missense	probably damaging	1.00
R2058:Ano1	UTSW	7	144648052	missense	probably damaging	1.00
R2059:Ano1	UTSW	7	144611390	missense	probably damaging	1.00
R2860:Ano1	UTSW	7	144590012	missense	probably damaging	1.00
R2861:Ano1	UTSW	7	144590012	missense	probably damaging	1.00
R3770:Ano1	UTSW	7	144595569	missense	probably damaging	1.00
R4179:Ano1	UTSW	7	144650505	missense	probably damaging	1.00
R4489:Ano1	UTSW	7	144611742	missense	probably benign	0.00
R4678:Ano1	UTSW	7	144669552	missense	probably benign	0.01
R4915:Ano1	UTSW	7	144611375	missense	possibly damaging	0.69
R5114:Ano1	UTSW	7	144657083	missense	possibly damaging	0.71
R5362:Ano1	UTSW	7	144648600	unclassified	probably benign
R5364:Ano1	UTSW	7	144637204	missense	probably damaging	1.00
R5366:Ano1	UTSW	7	144654209	missense	possibly damaging	0.85
R5387:Ano1	UTSW	7	144648619	missense	probably benign
R5762:Ano1	UTSW	7	144648037	missense	probably damaging	0.99
R5857:Ano1	UTSW	7	144637103	missense	probably benign	0.02
R6091:Ano1	UTSW	7	144669434	missense	probably benign	0.12
R6093:Ano1	UTSW	7	144611377	missense	possibly damaging	0.72
R6177:Ano1	UTSW	7	144678741	missense	possibly damaging	0.79
R6246:Ano1	UTSW	7	144633725	missense	possibly damaging	0.82
R6274:Ano1	UTSW	7	144618863	missense	probably benign	0.01
R6323:Ano1	UTSW	7	144611686	missense	possibly damaging	0.95
R6574:Ano1	UTSW	7	144607916	critical splice donor site	probably null
R6782:Ano1	UTSW	7	144621687	missense	probably damaging	1.00
R6880:Ano1	UTSW	7	144644742	missense	probably benign	0.00
R6909:Ano1	UTSW	7	144655731	missense	probably damaging	0.96
R7066:Ano1	UTSW	7	144637086	missense	probably benign	0.35
R7073:Ano1	UTSW	7	144638552	missense	probably damaging	0.96
R7146:Ano1	UTSW	7	144655656	missense	probably benign	0.00
R7420:Ano1	UTSW	7	144655641	missense	probably benign	0.00
R7874:Ano1	UTSW	7	144621724	missense	probably damaging	1.00
R8468:Ano1	UTSW	7	144655620	missense	probably damaging	1.00
R8867:Ano1	UTSW	7	144669660	missense	possibly damaging	0.66
R8923:Ano1	UTSW	7	144650551	missense	possibly damaging	0.61
R9215:Ano1	UTSW	7	144595605	missense	probably damaging	1.00
R9281:Ano1	UTSW	7	144595581	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATTTCTAATGTGGTAGCCTGTTTCC -3'
(R):5'- TAGCAGTGGTCCAGGCTTAG -3'

Sequencing Primer
(F):5'- ACTGGCTTGGCACTCATCAAG -3'
(R):5'- TCCAGGCTTAGGGCAGACAG -3'

Posted On

2015-04-29