Mutagenetix > Incidental Mutations

Incidental Mutation 'R3970:Pkd1l1'

310926

Institutional Source

Beutler Lab

Gene Symbol

Pkd1l1

Ensembl Gene

ENSMUSG00000046634

Gene Name

polycystic kidney disease 1 like 1

Synonyms

MMRRC Submission

040938-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R3970 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

8826708-8973266 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 8874218 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 1566 (E1566K)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000178195]

Predicted Effect

probably damaging
Transcript: ENSMUST00000154153
AA Change: E1566K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000120803
Gene: ENSMUSG00000046634
AA Change: E1566K

Domain	Start	End	E-Value	Type
low complexity region	172	184	N/A	INTRINSIC
PKD	205	287	2.9e0	SMART
PKD	291	369	1.42e-9	SMART
Pfam:REJ	398	1001	1.7e-45	PFAM
low complexity region	1208	1218	N/A	INTRINSIC
GPS	1370	1413	1.21e-1	SMART
transmembrane domain	1434	1451	N/A	INTRINSIC
LH2	1479	1598	2.94e-3	SMART
transmembrane domain	1640	1659	N/A	INTRINSIC
transmembrane domain	1679	1701	N/A	INTRINSIC
transmembrane domain	1817	1839	N/A	INTRINSIC
transmembrane domain	1854	1876	N/A	INTRINSIC
Pfam:PKD_channel	2109	2339	1.5e-23	PFAM
transmembrane domain	2381	2403	N/A	INTRINSIC
low complexity region	2436	2449	N/A	INTRINSIC
low complexity region	2458	2469	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000178195
AA Change: E1116K

PolyPhen 2 Score 0.726 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000136518
Gene: ENSMUSG00000046634
AA Change: E1116K

Domain	Start	End	E-Value	Type
Pfam:REJ	3	552	3.3e-41	PFAM
low complexity region	757	767	N/A	INTRINSIC
Blast:GPS	919	965	2e-13	BLAST
transmembrane domain	983	1000	N/A	INTRINSIC
Pfam:PLAT	1030	1145	7.2e-14	PFAM
transmembrane domain	1189	1208	N/A	INTRINSIC
transmembrane domain	1228	1250	N/A	INTRINSIC
transmembrane domain	1366	1388	N/A	INTRINSIC
transmembrane domain	1403	1425	N/A	INTRINSIC
Pfam:PKD_channel	1658	1889	2e-25	PFAM
transmembrane domain	1930	1952	N/A	INTRINSIC
low complexity region	1985	1998	N/A	INTRINSIC
low complexity region	2007	2018	N/A	INTRINSIC

Meta Mutation Damage Score

0.1240

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.4%

Validation Efficiency

96% (53/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycystin protein family containing 11 transmembrane domains, a receptor for egg jelly (REJ) domain, and a polycystin-1, lipoxygenase, alpha-toxin (PLAT) domain. The encoded protein may play a role in the male reproductive system. Alternative splice variants have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU induced point mutation display lethality throughout fetal growth and development with abnormalities in left right patterning and heterotaxia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2510039O18Rik	T	C	4: 147,945,322	M583T	probably damaging	Het
Actn4	T	C	7: 28,962,032	K51R	probably benign	Het
Adamts15	T	C	9: 30,910,602	Y513C	probably benign	Het
Akap13	T	A	7: 75,569,951	L34*	probably null	Het
Akap6	A	T	12: 53,141,453	K1883N	probably damaging	Het
Ano1	T	C	7: 144,607,963	N749D	probably benign	Het
Armcx6	G	T	X: 134,749,756	H109N	possibly damaging	Het
Camk4	T	A	18: 33,179,581	I258N	possibly damaging	Het
Cdhr2	A	T	13: 54,726,458	N781I	probably damaging	Het
Cherp	T	C	8: 72,469,951	H196R	possibly damaging	Het
Chia1	T	G	3: 106,121,635		probably null	Het
Col11a1	A	T	3: 114,097,189	T392S	unknown	Het
Commd9	C	A	2: 101,897,141	N93K	probably benign	Het
Csf2rb	T	C	15: 78,341,467	V286A	probably benign	Het
Dnah17	G	A	11: 118,041,158		probably benign	Het
E2f1	C	G	2: 154,564,022	G144R	probably damaging	Het
Fam196b	A	T	11: 34,419,739	Q481L	probably damaging	Het
Fcho2	A	T	13: 98,735,056	S551T	probably benign	Het
Flna	A	T	X: 74,235,667	V1253E	probably damaging	Het
Gm12185	A	T	11: 48,907,345	C774S	probably benign	Het
Gm14401	T	C	2: 177,086,996	Y292H	possibly damaging	Het
Kif5c	A	G	2: 49,688,744	E128G	probably damaging	Het
Lama3	A	T	18: 12,580,341	K3230M	probably damaging	Het
Myof	C	T	19: 37,901,263	V1287M	probably damaging	Het
Myof	T	G	19: 38,022,610	D60A	possibly damaging	Het
Myrf	A	G	19: 10,223,237	L332P	probably damaging	Het
Nampt	T	A	12: 32,833,096	D93E	probably benign	Het
Narf	A	T	11: 121,238,421	E10D	possibly damaging	Het
Nlrp6	C	A	7: 140,921,655	A45E	probably damaging	Het
Obscn	G	A	11: 59,051,662	P4898L	probably damaging	Het
Olfr251	T	C	9: 38,377,926	V15A	probably damaging	Het
Pabpc5	A	G	X: 119,928,624	E212G	probably benign	Het
Pcdh8	C	T	14: 79,770,266	G286S	possibly damaging	Het
Pcdha2	C	A	18: 36,940,697	Y460*	probably null	Het
Pcdhga4	G	T	18: 37,687,601	L734F	possibly damaging	Het
Pecr	G	A	1: 72,276,309	T94I	probably damaging	Het
Piezo2	A	T	18: 63,011,696	V2776E	probably damaging	Het
Pign	A	C	1: 105,656,003	S125A	probably damaging	Het
Pik3r2	G	A	8: 70,770,421	R452C	probably benign	Het
Plcb2	A	G	2: 118,715,690		probably benign	Het
Ppl	T	C	16: 5,100,332		probably null	Het
Pramel4	A	T	4: 144,068,474	N477I	possibly damaging	Het
Psd	C	T	19: 46,324,406	R175H	probably benign	Het
Sema3g	T	C	14: 31,226,521		probably null	Het
Sf3b1	G	A	1: 55,012,182	R196*	probably null	Het
Slc26a4	G	T	12: 31,528,687	H656N	probably damaging	Het
Slc6a7	A	C	18: 61,003,345	L328R	possibly damaging	Het
Stab2	T	C	10: 86,878,886	T139A	probably damaging	Het
Tiam2	T	A	17: 3,428,831	I613N	probably damaging	Het
Tlk1	A	G	2: 70,716,652	V695A	probably damaging	Het
Trpc2	A	G	7: 102,084,324	D160G	probably damaging	Het
Uhrf2	T	C	19: 30,079,915	V491A	probably damaging	Het
Vwa7	G	A	17: 35,017,708	A84T	probably damaging	Het
Zfp219	T	A	14: 52,006,964	Q541L	probably benign	Het

Other mutations in Pkd1l1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00093:Pkd1l1	APN	11	8961971	missense	unknown
IGL00156:Pkd1l1	APN	11	8950515	missense	probably damaging	1.00
IGL00161:Pkd1l1	APN	11	8929353	critical splice donor site	probably null
IGL00489:Pkd1l1	APN	11	8834773	critical splice donor site	probably null
IGL00495:Pkd1l1	APN	11	8868493	missense	probably benign	0.34
IGL00983:Pkd1l1	APN	11	8844585	missense	probably benign
IGL01071:Pkd1l1	APN	11	8848921	missense	probably benign	0.00
IGL01093:Pkd1l1	APN	11	8901345	missense	probably benign	0.06
IGL01295:Pkd1l1	APN	11	8933685	missense	possibly damaging	0.93
IGL01311:Pkd1l1	APN	11	8901174	missense	possibly damaging	0.53
IGL01412:Pkd1l1	APN	11	8950409	missense	possibly damaging	0.73
IGL01978:Pkd1l1	APN	11	8961336	missense	unknown
IGL01999:Pkd1l1	APN	11	8836291	missense	probably benign
IGL02080:Pkd1l1	APN	11	8961345	missense	unknown
IGL02106:Pkd1l1	APN	11	8833800	missense	probably damaging	1.00
IGL02216:Pkd1l1	APN	11	8834897	missense	probably damaging	0.96
IGL02305:Pkd1l1	APN	11	8902467	missense	probably benign
IGL02337:Pkd1l1	APN	11	8942079	missense	probably damaging	1.00
IGL02576:Pkd1l1	APN	11	8844560	missense	possibly damaging	0.61
IGL02704:Pkd1l1	APN	11	8834910	missense	probably benign	0.00
IGL02814:Pkd1l1	APN	11	8902582	missense	probably benign	0.01
IGL02904:Pkd1l1	APN	11	8868450	splice site	probably benign
IGL02972:Pkd1l1	APN	11	8863908	missense	probably damaging	0.99
IGL03091:Pkd1l1	APN	11	8855564	missense	probably damaging	1.00
IGL03113:Pkd1l1	APN	11	8834793	missense	probably benign	0.20
IGL03210:Pkd1l1	APN	11	8965127	missense	unknown
PIT4581001:Pkd1l1	UTSW	11	8916298	frame shift	probably null
R0020:Pkd1l1	UTSW	11	8875765	splice site	probably benign
R0020:Pkd1l1	UTSW	11	8875765	splice site	probably benign
R0496:Pkd1l1	UTSW	11	8929430	missense	probably damaging	0.96
R0547:Pkd1l1	UTSW	11	8836448	splice site	probably benign
R0582:Pkd1l1	UTSW	11	8931699	splice site	probably benign
R0761:Pkd1l1	UTSW	11	8854375	missense	probably damaging	1.00
R0969:Pkd1l1	UTSW	11	8936898	missense	probably damaging	1.00
R1348:Pkd1l1	UTSW	11	8834806	missense	probably benign	0.18
R1366:Pkd1l1	UTSW	11	8941038	splice site	probably benign
R1401:Pkd1l1	UTSW	11	8854487	nonsense	probably null
R1444:Pkd1l1	UTSW	11	8854386	missense	probably damaging	1.00
R1445:Pkd1l1	UTSW	11	8870313	missense	probably benign	0.00
R1463:Pkd1l1	UTSW	11	8916302	missense	probably damaging	1.00
R1496:Pkd1l1	UTSW	11	8941077	missense	possibly damaging	0.95
R1542:Pkd1l1	UTSW	11	8874179	missense	possibly damaging	0.82
R1543:Pkd1l1	UTSW	11	8901200	missense	probably damaging	1.00
R1619:Pkd1l1	UTSW	11	8950413	missense	probably damaging	0.98
R1875:Pkd1l1	UTSW	11	8844670	splice site	probably benign
R1929:Pkd1l1	UTSW	11	8836197	splice site	probably benign
R1958:Pkd1l1	UTSW	11	8874161	missense	probably benign	0.01
R2223:Pkd1l1	UTSW	11	8889063	missense	probably benign	0.18
R2223:Pkd1l1	UTSW	11	8950422	missense	probably benign
R2264:Pkd1l1	UTSW	11	8879112	missense	probably damaging	0.97
R2349:Pkd1l1	UTSW	11	8826819	splice site	probably null
R2431:Pkd1l1	UTSW	11	8947197	missense	probably damaging	0.99
R2483:Pkd1l1	UTSW	11	8962701	missense	probably damaging	1.00
R2517:Pkd1l1	UTSW	11	8958900	missense	unknown
R2888:Pkd1l1	UTSW	11	8947251	missense	probably damaging	1.00
R2965:Pkd1l1	UTSW	11	8874236	missense	probably damaging	1.00
R3123:Pkd1l1	UTSW	11	8973021	missense	unknown
R3153:Pkd1l1	UTSW	11	8867207	missense	probably benign	0.01
R3840:Pkd1l1	UTSW	11	8889050	missense	probably damaging	1.00
R3855:Pkd1l1	UTSW	11	8965047	critical splice donor site	probably null
R3880:Pkd1l1	UTSW	11	8961983	missense	unknown
R4195:Pkd1l1	UTSW	11	8909929	missense	probably damaging	1.00
R4196:Pkd1l1	UTSW	11	8909929	missense	probably damaging	1.00
R4246:Pkd1l1	UTSW	11	8865543	missense	possibly damaging	0.51
R4247:Pkd1l1	UTSW	11	8865543	missense	possibly damaging	0.51
R4249:Pkd1l1	UTSW	11	8865543	missense	possibly damaging	0.51
R4250:Pkd1l1	UTSW	11	8865543	missense	possibly damaging	0.51
R4593:Pkd1l1	UTSW	11	8901253	missense	probably damaging	0.97
R4609:Pkd1l1	UTSW	11	8958964	missense	unknown
R4797:Pkd1l1	UTSW	11	8961340	missense	unknown
R4910:Pkd1l1	UTSW	11	8929360	missense	possibly damaging	0.50
R4940:Pkd1l1	UTSW	11	8844585	missense	probably benign
R5084:Pkd1l1	UTSW	11	8942004	missense	probably benign	0.05
R5147:Pkd1l1	UTSW	11	8849003	missense	possibly damaging	0.71
R5360:Pkd1l1	UTSW	11	8879204	missense	probably benign
R5483:Pkd1l1	UTSW	11	8901141	critical splice donor site	probably null
R5604:Pkd1l1	UTSW	11	8833877	missense	probably damaging	0.98
R5642:Pkd1l1	UTSW	11	8879202	missense	probably damaging	1.00
R5652:Pkd1l1	UTSW	11	8909889	missense	probably benign	0.03
R5751:Pkd1l1	UTSW	11	8867204	missense	possibly damaging	0.45
R5761:Pkd1l1	UTSW	11	8916301	missense	probably damaging	1.00
R5800:Pkd1l1	UTSW	11	8861302	missense	probably benign
R5874:Pkd1l1	UTSW	11	8908688	missense	probably damaging	1.00
R5897:Pkd1l1	UTSW	11	8879176	missense	probably benign	0.03
R5913:Pkd1l1	UTSW	11	8863849	missense	probably benign	0.00
R5930:Pkd1l1	UTSW	11	8958969	missense	unknown
R6000:Pkd1l1	UTSW	11	8950427	missense	probably benign	0.00
R6005:Pkd1l1	UTSW	11	8857113	missense	probably damaging	1.00
R6013:Pkd1l1	UTSW	11	8869452	splice site	probably null
R6027:Pkd1l1	UTSW	11	8916272	nonsense	probably null
R6028:Pkd1l1	UTSW	11	8836267	missense	probably benign	0.06
R6129:Pkd1l1	UTSW	11	8868543	missense	probably benign	0.00
R6182:Pkd1l1	UTSW	11	8865555	missense	probably benign	0.36
R6226:Pkd1l1	UTSW	11	8901287	missense	probably benign	0.00
R6257:Pkd1l1	UTSW	11	8942195	missense	probably benign	0.22
R6340:Pkd1l1	UTSW	11	8844649	missense	probably benign	0.09
R6478:Pkd1l1	UTSW	11	8863911	missense	probably benign	0.00
R6558:Pkd1l1	UTSW	11	8889052	missense	probably benign	0.00
R6750:Pkd1l1	UTSW	11	8973217	missense	unknown
R6987:Pkd1l1	UTSW	11	8902575	missense	probably benign	0.01
R6996:Pkd1l1	UTSW	11	8849046	missense	probably damaging	1.00
R7139:Pkd1l1	UTSW	11	8890737	missense
R7224:Pkd1l1	UTSW	11	8945241	missense
R7244:Pkd1l1	UTSW	11	8871771	missense
R7265:Pkd1l1	UTSW	11	8929402	missense
R7358:Pkd1l1	UTSW	11	8945202	missense
R7387:Pkd1l1	UTSW	11	8901203	missense
R7414:Pkd1l1	UTSW	11	8916267	missense
R7459:Pkd1l1	UTSW	11	8902428	missense
R7478:Pkd1l1	UTSW	11	8929441	missense
R7485:Pkd1l1	UTSW	11	8965148	missense
R7490:Pkd1l1	UTSW	11	8916265	missense
R7644:Pkd1l1	UTSW	11	8875758	missense
R7647:Pkd1l1	UTSW	11	8947296	missense
R7676:Pkd1l1	UTSW	11	8962708	missense
R7687:Pkd1l1	UTSW	11	8854390	missense
R7699:Pkd1l1	UTSW	11	8965142	missense
R7922:Pkd1l1	UTSW	11	8849013	missense
R7922:Pkd1l1	UTSW	11	8909857	missense
R7980:Pkd1l1	UTSW	11	8854375	missense	probably damaging	1.00
R7993:Pkd1l1	UTSW	11	8945262	missense
R8052:Pkd1l1	UTSW	11	8947315	missense
R8125:Pkd1l1	UTSW	11	8947241	missense	probably damaging	1.00
R8420:Pkd1l1	UTSW	11	8870277	nonsense	probably null
X0024:Pkd1l1	UTSW	11	8950413	missense	probably benign	0.01
X0063:Pkd1l1	UTSW	11	8929430	missense	probably damaging	0.96
X0065:Pkd1l1	UTSW	11	8909921	missense	probably benign	0.10
Z1176:Pkd1l1	UTSW	11	8826801	missense
Z1177:Pkd1l1	UTSW	11	8945208	missense

Predicted Primers

PCR Primer
(F):5'- ACCAAAGAATACCAGCCATTTTGG -3'
(R):5'- GTGTGCCCCTACTAGTCACAATG -3'

Sequencing Primer
(F):5'- GTATATCACGGGTCACCTGCATG -3'
(R):5'- CCCTAATGGCCATGTCAGAGTTG -3'

Posted On

2015-04-29