Mutagenetix > Incidental Mutation

Incidental Mutation 'R3970:Narf'

310932

Institutional Source

Beutler Lab

Gene Symbol

Narf

Ensembl Gene

ENSMUSG00000000056

Gene Name

nuclear prelamin A recognition factor

Synonyms

4430402O11Rik

MMRRC Submission

040938-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.132) question?

Stock #

R3970 (G1)

Quality Score

164

Status

Validated

Chromosome

Chromosomal Location

121128079-121146682 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 121129247 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Aspartic acid at position 10 (E10D)

Ref Sequence

ENSEMBL: ENSMUSP00000099304 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000103015]

AlphaFold

Q9CYQ7

Predicted Effect

possibly damaging
Transcript: ENSMUST00000103015
AA Change: E10D

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000099304
Gene: ENSMUSG00000000056
AA Change: E10D

Domain	Start	End	E-Value	Type
Pfam:Fe_hyd_lg_C	98	391	1e-75	PFAM
Fe_hyd_SSU	396	452	5.66e-19	SMART

Meta Mutation Damage Score

0.0608

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.4%

Validation Efficiency

96% (53/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Several proteins have been found to be prenylated and methylated at their carboxyl-terminal ends. Prenylation was initially believed to be important only for membrane attachment. However, another role for prenylation appears to be its importance in protein-protein interactions. The only nuclear proteins known to be prenylated in mammalian cells are prelamin A- and B-type lamins. Prelamin A is farnesylated and carboxymethylated on the cysteine residue of a carboxyl-terminal CaaX motif. This post-translationally modified cysteine residue is removed from prelamin A when it is endoproteolytically processed into mature lamin A. The protein encoded by this gene binds to the prenylated prelamin A carboxyl-terminal tail domain. It may be a component of a prelamin A endoprotease complex. The encoded protein is located in the nucleus, where it partially colocalizes with the nuclear lamina. It shares limited sequence similarity with iron-only bacterial hydrogenases. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene, including one with a novel exon that is generated by RNA editing. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2510039O18Rik	T	C	4: 148,029,779 (GRCm39)	M583T	probably damaging	Het
Actn4	T	C	7: 28,661,457 (GRCm39)	K51R	probably benign	Het
Adamts15	T	C	9: 30,821,898 (GRCm39)	Y513C	probably benign	Het
Akap13	T	A	7: 75,219,699 (GRCm39)	L34*	probably null	Het
Akap6	A	T	12: 53,188,236 (GRCm39)	K1883N	probably damaging	Het
Ano1	T	C	7: 144,161,700 (GRCm39)	N749D	probably benign	Het
Armcx6	G	T	X: 133,650,505 (GRCm39)	H109N	possibly damaging	Het
Camk4	T	A	18: 33,312,634 (GRCm39)	I258N	possibly damaging	Het
Cdhr2	A	T	13: 54,874,271 (GRCm39)	N781I	probably damaging	Het
Cherp	T	C	8: 73,223,795 (GRCm39)	H196R	possibly damaging	Het
Chia1	T	G	3: 106,028,951 (GRCm39)		probably null	Het
Col11a1	A	T	3: 113,890,838 (GRCm39)	T392S	unknown	Het
Commd9	C	A	2: 101,727,486 (GRCm39)	N93K	probably benign	Het
Csf2rb	T	C	15: 78,225,667 (GRCm39)	V286A	probably benign	Het
Dnah17	G	A	11: 117,931,984 (GRCm39)		probably benign	Het
E2f1	C	G	2: 154,405,942 (GRCm39)	G144R	probably damaging	Het
Fcho2	A	T	13: 98,871,564 (GRCm39)	S551T	probably benign	Het
Flna	A	T	X: 73,279,273 (GRCm39)	V1253E	probably damaging	Het
Gm12185	A	T	11: 48,798,172 (GRCm39)	C774S	probably benign	Het
Gm14401	T	C	2: 176,778,789 (GRCm39)	Y292H	possibly damaging	Het
Insyn2b	A	T	11: 34,369,739 (GRCm39)	Q481L	probably damaging	Het
Kif5c	A	G	2: 49,578,756 (GRCm39)	E128G	probably damaging	Het
Lama3	A	T	18: 12,713,398 (GRCm39)	K3230M	probably damaging	Het
Myof	C	T	19: 37,889,711 (GRCm39)	V1287M	probably damaging	Het
Myof	T	G	19: 38,011,058 (GRCm39)	D60A	possibly damaging	Het
Myrf	A	G	19: 10,200,601 (GRCm39)	L332P	probably damaging	Het
Nampt	T	A	12: 32,883,095 (GRCm39)	D93E	probably benign	Het
Nlrp6	C	A	7: 140,501,568 (GRCm39)	A45E	probably damaging	Het
Obscn	G	A	11: 58,942,488 (GRCm39)	P4898L	probably damaging	Het
Or8c11	T	C	9: 38,289,222 (GRCm39)	V15A	probably damaging	Het
Pabpc5	A	G	X: 118,838,321 (GRCm39)	E212G	probably benign	Het
Pcdh8	C	T	14: 80,007,706 (GRCm39)	G286S	possibly damaging	Het
Pcdha2	C	A	18: 37,073,750 (GRCm39)	Y460*	probably null	Het
Pcdhga4	G	T	18: 37,820,654 (GRCm39)	L734F	possibly damaging	Het
Pecr	G	A	1: 72,315,468 (GRCm39)	T94I	probably damaging	Het
Piezo2	A	T	18: 63,144,767 (GRCm39)	V2776E	probably damaging	Het
Pign	A	C	1: 105,583,728 (GRCm39)	S125A	probably damaging	Het
Pik3r2	G	A	8: 71,223,065 (GRCm39)	R452C	probably benign	Het
Pkd1l1	C	T	11: 8,824,218 (GRCm39)	E1566K	probably damaging	Het
Plcb2	A	G	2: 118,546,171 (GRCm39)		probably benign	Het
Ppl	T	C	16: 4,918,196 (GRCm39)		probably null	Het
Pramel4	A	T	4: 143,795,044 (GRCm39)	N477I	possibly damaging	Het
Psd	C	T	19: 46,312,845 (GRCm39)	R175H	probably benign	Het
Sema3g	T	C	14: 30,948,478 (GRCm39)		probably null	Het
Sf3b1	G	A	1: 55,051,341 (GRCm39)	R196*	probably null	Het
Slc26a4	G	T	12: 31,578,686 (GRCm39)	H656N	probably damaging	Het
Slc6a7	A	C	18: 61,136,417 (GRCm39)	L328R	possibly damaging	Het
Stab2	T	C	10: 86,714,750 (GRCm39)	T139A	probably damaging	Het
Tiam2	T	A	17: 3,479,106 (GRCm39)	I613N	probably damaging	Het
Tlk1	A	G	2: 70,546,996 (GRCm39)	V695A	probably damaging	Het
Trpc2	A	G	7: 101,733,531 (GRCm39)	D160G	probably damaging	Het
Uhrf2	T	C	19: 30,057,315 (GRCm39)	V491A	probably damaging	Het
Vwa7	G	A	17: 35,236,684 (GRCm39)	A84T	probably damaging	Het
Zfp219	T	A	14: 52,244,421 (GRCm39)	Q541L	probably benign	Het

Other mutations in Narf

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Narf	APN	11	121,129,344 (GRCm39)	critical splice donor site	probably null
R0128:Narf	UTSW	11	121,141,662 (GRCm39)	missense	probably damaging	1.00
R0542:Narf	UTSW	11	121,143,690 (GRCm39)	missense	probably damaging	1.00
R1326:Narf	UTSW	11	121,133,379 (GRCm39)	missense	probably damaging	1.00
R2035:Narf	UTSW	11	121,129,326 (GRCm39)	missense	probably benign	0.00
R2049:Narf	UTSW	11	121,141,195 (GRCm39)	nonsense	probably null
R2078:Narf	UTSW	11	121,136,220 (GRCm39)	missense	probably benign	0.03
R3711:Narf	UTSW	11	121,137,764 (GRCm39)	nonsense	probably null
R3967:Narf	UTSW	11	121,129,247 (GRCm39)	missense	possibly damaging	0.92
R3968:Narf	UTSW	11	121,129,247 (GRCm39)	missense	possibly damaging	0.92
R4128:Narf	UTSW	11	121,141,261 (GRCm39)	splice site	probably null
R4913:Narf	UTSW	11	121,135,469 (GRCm39)	missense	probably damaging	1.00
R4928:Narf	UTSW	11	121,135,765 (GRCm39)	missense	possibly damaging	0.87
R4946:Narf	UTSW	11	121,141,179 (GRCm39)	missense	possibly damaging	0.71
R5404:Narf	UTSW	11	121,133,452 (GRCm39)	missense	probably benign	0.00
R5799:Narf	UTSW	11	121,135,480 (GRCm39)	missense	probably damaging	1.00
R6753:Narf	UTSW	11	121,133,452 (GRCm39)	missense	probably benign	0.00
R6912:Narf	UTSW	11	121,129,287 (GRCm39)	missense	probably benign	0.00
R7311:Narf	UTSW	11	121,139,976 (GRCm39)	missense	probably benign	0.31
R8056:Narf	UTSW	11	121,136,170 (GRCm39)	missense	possibly damaging	0.89
R8559:Narf	UTSW	11	121,141,258 (GRCm39)	critical splice donor site	probably null
R9021:Narf	UTSW	11	121,136,209 (GRCm39)	missense	probably damaging	0.98
X0011:Narf	UTSW	11	121,141,698 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CGACTGCTCAGGATATGTTTTG -3'
(R):5'- TCACGTTAGGCTGACACAAACC -3'

Sequencing Primer
(F):5'- CCAATGATCCCAGTGCTTGAGAG -3'
(R):5'- GTTAGGCTGACACAAACCCGATC -3'

Posted On

2015-04-29