Incidental Mutation 'R3970:Slc26a4'
ID310933
Institutional Source Beutler Lab
Gene Symbol Slc26a4
Ensembl Gene ENSMUSG00000020651
Gene Namesolute carrier family 26, member 4
SynonymsPds, pendrin
MMRRC Submission 040938-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3970 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location31519827-31559969 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 31528687 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 656 (H656N)
Ref Sequence ENSEMBL: ENSMUSP00000001253 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001253]
Predicted Effect probably damaging
Transcript: ENSMUST00000001253
AA Change: H656N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000001253
Gene: ENSMUSG00000020651
AA Change: H656N

DomainStartEndE-ValueType
low complexity region 33 47 N/A INTRINSIC
Pfam:Sulfate_transp 84 485 1e-105 PFAM
low complexity region 492 507 N/A INTRINSIC
Pfam:STAS 536 725 1.4e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218992
Meta Mutation Damage Score 0.5350 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mutations in this gene are associated with Pendred syndrome, the most common form of syndromic deafness, an autosomal-recessive disease. It is highly homologous to the SLC26A3 gene; they have similar genomic structures and this gene is located 3' of the SLC26A3 gene. The encoded protein has homology to sulfate transporters. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are completely deaf with vestibular dysfunction. Mutants show endolymphatic dilatation, degeneration of sensory cells and malformations of otoconia and otoconial membranes. They display unsteady gait and circling and head bobbing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik T C 4: 147,945,322 M583T probably damaging Het
Actn4 T C 7: 28,962,032 K51R probably benign Het
Adamts15 T C 9: 30,910,602 Y513C probably benign Het
Akap13 T A 7: 75,569,951 L34* probably null Het
Akap6 A T 12: 53,141,453 K1883N probably damaging Het
Ano1 T C 7: 144,607,963 N749D probably benign Het
Armcx6 G T X: 134,749,756 H109N possibly damaging Het
Camk4 T A 18: 33,179,581 I258N possibly damaging Het
Cdhr2 A T 13: 54,726,458 N781I probably damaging Het
Cherp T C 8: 72,469,951 H196R possibly damaging Het
Chia1 T G 3: 106,121,635 probably null Het
Col11a1 A T 3: 114,097,189 T392S unknown Het
Commd9 C A 2: 101,897,141 N93K probably benign Het
Csf2rb T C 15: 78,341,467 V286A probably benign Het
Dnah17 G A 11: 118,041,158 probably benign Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Fam196b A T 11: 34,419,739 Q481L probably damaging Het
Fcho2 A T 13: 98,735,056 S551T probably benign Het
Flna A T X: 74,235,667 V1253E probably damaging Het
Gm12185 A T 11: 48,907,345 C774S probably benign Het
Gm14401 T C 2: 177,086,996 Y292H possibly damaging Het
Kif5c A G 2: 49,688,744 E128G probably damaging Het
Lama3 A T 18: 12,580,341 K3230M probably damaging Het
Myof C T 19: 37,901,263 V1287M probably damaging Het
Myof T G 19: 38,022,610 D60A possibly damaging Het
Myrf A G 19: 10,223,237 L332P probably damaging Het
Nampt T A 12: 32,833,096 D93E probably benign Het
Narf A T 11: 121,238,421 E10D possibly damaging Het
Nlrp6 C A 7: 140,921,655 A45E probably damaging Het
Obscn G A 11: 59,051,662 P4898L probably damaging Het
Olfr251 T C 9: 38,377,926 V15A probably damaging Het
Pabpc5 A G X: 119,928,624 E212G probably benign Het
Pcdh8 C T 14: 79,770,266 G286S possibly damaging Het
Pcdha2 C A 18: 36,940,697 Y460* probably null Het
Pcdhga4 G T 18: 37,687,601 L734F possibly damaging Het
Pecr G A 1: 72,276,309 T94I probably damaging Het
Piezo2 A T 18: 63,011,696 V2776E probably damaging Het
Pign A C 1: 105,656,003 S125A probably damaging Het
Pik3r2 G A 8: 70,770,421 R452C probably benign Het
Pkd1l1 C T 11: 8,874,218 E1566K probably damaging Het
Plcb2 A G 2: 118,715,690 probably benign Het
Ppl T C 16: 5,100,332 probably null Het
Pramel4 A T 4: 144,068,474 N477I possibly damaging Het
Psd C T 19: 46,324,406 R175H probably benign Het
Sema3g T C 14: 31,226,521 probably null Het
Sf3b1 G A 1: 55,012,182 R196* probably null Het
Slc6a7 A C 18: 61,003,345 L328R possibly damaging Het
Stab2 T C 10: 86,878,886 T139A probably damaging Het
Tiam2 T A 17: 3,428,831 I613N probably damaging Het
Tlk1 A G 2: 70,716,652 V695A probably damaging Het
Trpc2 A G 7: 102,084,324 D160G probably damaging Het
Uhrf2 T C 19: 30,079,915 V491A probably damaging Het
Vwa7 G A 17: 35,017,708 A84T probably damaging Het
Zfp219 T A 14: 52,006,964 Q541L probably benign Het
Other mutations in Slc26a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01754:Slc26a4 APN 12 31528854 splice site probably benign
IGL01763:Slc26a4 APN 12 31528854 splice site probably benign
IGL01778:Slc26a4 APN 12 31528854 splice site probably benign
IGL01779:Slc26a4 APN 12 31528854 splice site probably benign
IGL01872:Slc26a4 APN 12 31539203 missense probably benign 0.22
IGL02016:Slc26a4 APN 12 31535667 missense probably damaging 0.99
IGL02184:Slc26a4 APN 12 31549949 missense probably damaging 1.00
IGL02267:Slc26a4 APN 12 31528854 splice site probably benign
IGL02270:Slc26a4 APN 12 31528854 splice site probably benign
IGL02271:Slc26a4 APN 12 31528854 splice site probably benign
IGL02347:Slc26a4 APN 12 31528854 splice site probably benign
IGL02543:Slc26a4 APN 12 31528689 missense possibly damaging 0.75
IGL02803:Slc26a4 APN 12 31522527 critical splice acceptor site probably null
IGL02885:Slc26a4 APN 12 31525476 missense probably benign 0.00
IGL02974:Slc26a4 APN 12 31529554 missense probably damaging 1.00
IGL03037:Slc26a4 APN 12 31531687 splice site probably benign
cul-de-sac UTSW 12 31525568 nonsense probably null
discobolus UTSW 12 31540533 nonsense probably null
R0152:Slc26a4 UTSW 12 31529498 missense probably damaging 1.00
R0677:Slc26a4 UTSW 12 31549911 critical splice donor site probably null
R0961:Slc26a4 UTSW 12 31535619 missense probably benign
R1025:Slc26a4 UTSW 12 31528737 missense probably damaging 1.00
R1301:Slc26a4 UTSW 12 31525568 nonsense probably null
R1729:Slc26a4 UTSW 12 31544494 missense possibly damaging 0.95
R2321:Slc26a4 UTSW 12 31540544 missense probably damaging 1.00
R3967:Slc26a4 UTSW 12 31528687 missense probably damaging 1.00
R4007:Slc26a4 UTSW 12 31540533 nonsense probably null
R4370:Slc26a4 UTSW 12 31529476 missense probably benign 0.01
R4647:Slc26a4 UTSW 12 31540526 missense possibly damaging 0.90
R4648:Slc26a4 UTSW 12 31540526 missense possibly damaging 0.90
R5816:Slc26a4 UTSW 12 31528685 missense probably damaging 1.00
R5932:Slc26a4 UTSW 12 31535249 critical splice donor site probably null
R6675:Slc26a4 UTSW 12 31540513 missense possibly damaging 0.89
R6732:Slc26a4 UTSW 12 31526600 critical splice donor site probably null
R6890:Slc26a4 UTSW 12 31549951 missense possibly damaging 0.79
R7231:Slc26a4 UTSW 12 31547946 missense probably damaging 1.00
R7286:Slc26a4 UTSW 12 31529528 nonsense probably null
R7790:Slc26a4 UTSW 12 31544483 missense probably damaging 1.00
R7812:Slc26a4 UTSW 12 31544450 missense probably damaging 1.00
X0022:Slc26a4 UTSW 12 31535687 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCACGGTCCATTTATGTTCTTAG -3'
(R):5'- ATTGACAAGTAAGTCCGAGGTG -3'

Sequencing Primer
(F):5'- AGCCTGACTGCAGAGCTTATG -3'
(R):5'- ACAAGTAAGTCCGAGGTGTTTTC -3'
Posted On2015-04-29