Mutagenetix > Incidental Mutations

Incidental Mutation 'R3970:Cdhr2'

310936

Institutional Source

Beutler Lab

Gene Symbol

Cdhr2

Ensembl Gene

ENSMUSG00000034918

Gene Name

cadherin-related family member 2

Synonyms

LOC268663, Pcdh24

MMRRC Submission

040938-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.067) question?

Stock #

R3970 (G1)

Quality Score

210

Status

Validated

Chromosome

Chromosomal Location

54701461-54736662 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 54726458 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Isoleucine at position 781 (N781I)

Ref Sequence

ENSEMBL: ENSMUSP00000043596 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037145]

Predicted Effect

probably damaging
Transcript: ENSMUST00000037145
AA Change: N781I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000043596
Gene: ENSMUSG00000034918
AA Change: N781I

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
CA	48	122	8.62e-15	SMART
CA	146	239	1.4e-2	SMART
CA	263	351	2.19e-16	SMART
CA	391	478	4.22e-9	SMART
CA	503	584	2.15e-24	SMART
CA	605	693	6.78e-22	SMART
CA	715	805	1.78e-16	SMART
CA	830	925	7.57e-11	SMART
CA	950	1042	7.1e-2	SMART
low complexity region	1121	1147	N/A	INTRINSIC
transmembrane domain	1153	1175	N/A	INTRINSIC
low complexity region	1195	1209	N/A	INTRINSIC
low complexity region	1234	1250	N/A	INTRINSIC
low complexity region	1264	1277	N/A	INTRINSIC

Meta Mutation Damage Score

0.5002

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.4%

Validation Efficiency

96% (53/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin family, which represents a subset of the larger cadherin superfamily. The members of the protocadherin family encode non-classical cadherins that function as calcium-dependent cell-cell adhesion molecules. This protocadherin represents a new candidate for tumor suppression. Alternatively spliced transcript variants that encode the same protein have been identified. [provided by RefSeq, Jan 2010]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2510039O18Rik	T	C	4: 147,945,322	M583T	probably damaging	Het
Actn4	T	C	7: 28,962,032	K51R	probably benign	Het
Adamts15	T	C	9: 30,910,602	Y513C	probably benign	Het
Akap13	T	A	7: 75,569,951	L34*	probably null	Het
Akap6	A	T	12: 53,141,453	K1883N	probably damaging	Het
Ano1	T	C	7: 144,607,963	N749D	probably benign	Het
Armcx6	G	T	X: 134,749,756	H109N	possibly damaging	Het
Camk4	T	A	18: 33,179,581	I258N	possibly damaging	Het
Cherp	T	C	8: 72,469,951	H196R	possibly damaging	Het
Chia1	T	G	3: 106,121,635		probably null	Het
Col11a1	A	T	3: 114,097,189	T392S	unknown	Het
Commd9	C	A	2: 101,897,141	N93K	probably benign	Het
Csf2rb	T	C	15: 78,341,467	V286A	probably benign	Het
Dnah17	G	A	11: 118,041,158		probably benign	Het
E2f1	C	G	2: 154,564,022	G144R	probably damaging	Het
Fam196b	A	T	11: 34,419,739	Q481L	probably damaging	Het
Fcho2	A	T	13: 98,735,056	S551T	probably benign	Het
Flna	A	T	X: 74,235,667	V1253E	probably damaging	Het
Gm12185	A	T	11: 48,907,345	C774S	probably benign	Het
Gm14401	T	C	2: 177,086,996	Y292H	possibly damaging	Het
Kif5c	A	G	2: 49,688,744	E128G	probably damaging	Het
Lama3	A	T	18: 12,580,341	K3230M	probably damaging	Het
Myof	C	T	19: 37,901,263	V1287M	probably damaging	Het
Myof	T	G	19: 38,022,610	D60A	possibly damaging	Het
Myrf	A	G	19: 10,223,237	L332P	probably damaging	Het
Nampt	T	A	12: 32,833,096	D93E	probably benign	Het
Narf	A	T	11: 121,238,421	E10D	possibly damaging	Het
Nlrp6	C	A	7: 140,921,655	A45E	probably damaging	Het
Obscn	G	A	11: 59,051,662	P4898L	probably damaging	Het
Olfr251	T	C	9: 38,377,926	V15A	probably damaging	Het
Pabpc5	A	G	X: 119,928,624	E212G	probably benign	Het
Pcdh8	C	T	14: 79,770,266	G286S	possibly damaging	Het
Pcdha2	C	A	18: 36,940,697	Y460*	probably null	Het
Pcdhga4	G	T	18: 37,687,601	L734F	possibly damaging	Het
Pecr	G	A	1: 72,276,309	T94I	probably damaging	Het
Piezo2	A	T	18: 63,011,696	V2776E	probably damaging	Het
Pign	A	C	1: 105,656,003	S125A	probably damaging	Het
Pik3r2	G	A	8: 70,770,421	R452C	probably benign	Het
Pkd1l1	C	T	11: 8,874,218	E1566K	probably damaging	Het
Plcb2	A	G	2: 118,715,690		probably benign	Het
Ppl	T	C	16: 5,100,332		probably null	Het
Pramel4	A	T	4: 144,068,474	N477I	possibly damaging	Het
Psd	C	T	19: 46,324,406	R175H	probably benign	Het
Sema3g	T	C	14: 31,226,521		probably null	Het
Sf3b1	G	A	1: 55,012,182	R196*	probably null	Het
Slc26a4	G	T	12: 31,528,687	H656N	probably damaging	Het
Slc6a7	A	C	18: 61,003,345	L328R	possibly damaging	Het
Stab2	T	C	10: 86,878,886	T139A	probably damaging	Het
Tiam2	T	A	17: 3,428,831	I613N	probably damaging	Het
Tlk1	A	G	2: 70,716,652	V695A	probably damaging	Het
Trpc2	A	G	7: 102,084,324	D160G	probably damaging	Het
Uhrf2	T	C	19: 30,079,915	V491A	probably damaging	Het
Vwa7	G	A	17: 35,017,708	A84T	probably damaging	Het
Zfp219	T	A	14: 52,006,964	Q541L	probably benign	Het

Other mutations in Cdhr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00565:Cdhr2	APN	13	54718299	missense	probably damaging	1.00
IGL00596:Cdhr2	APN	13	54720997	missense	probably damaging	0.97
IGL00840:Cdhr2	APN	13	54720152	missense	probably damaging	0.96
IGL00956:Cdhr2	APN	13	54718343	missense	probably damaging	1.00
IGL01101:Cdhr2	APN	13	54718135	splice site	probably benign
IGL01150:Cdhr2	APN	13	54731118	missense	probably benign
IGL01412:Cdhr2	APN	13	54725894	missense	probably damaging	1.00
IGL01515:Cdhr2	APN	13	54718238	missense	probably benign	0.17
IGL02005:Cdhr2	APN	13	54719763	missense	probably benign	0.00
IGL02187:Cdhr2	APN	13	54733710	missense	possibly damaging	0.86
IGL02312:Cdhr2	APN	13	54717888	missense	probably null	0.97
IGL02877:Cdhr2	APN	13	54734737	missense	probably benign	0.39
IGL03072:Cdhr2	APN	13	54726661	missense	probably benign	0.00
IGL03263:Cdhr2	APN	13	54718113	missense	possibly damaging	0.75
FR4449:Cdhr2	UTSW	13	54725924	small insertion	probably benign
PIT4494001:Cdhr2	UTSW	13	54718442	critical splice acceptor site	probably null
PIT4498001:Cdhr2	UTSW	13	54718239	missense	possibly damaging	0.75
R0041:Cdhr2	UTSW	13	54726838	missense	probably damaging	1.00
R0149:Cdhr2	UTSW	13	54734007	missense	probably damaging	1.00
R0329:Cdhr2	UTSW	13	54734801	unclassified	probably benign
R0361:Cdhr2	UTSW	13	54734007	missense	probably damaging	1.00
R0365:Cdhr2	UTSW	13	54718292	missense	probably benign	0.00
R0598:Cdhr2	UTSW	13	54726739	missense	probably damaging	1.00
R0774:Cdhr2	UTSW	13	54717855	missense	probably damaging	1.00
R1330:Cdhr2	UTSW	13	54734268	missense	possibly damaging	0.67
R1458:Cdhr2	UTSW	13	54717872	missense	probably damaging	0.99
R1659:Cdhr2	UTSW	13	54719761	missense	probably damaging	1.00
R1698:Cdhr2	UTSW	13	54719581	missense	probably benign	0.00
R2061:Cdhr2	UTSW	13	54720818	missense	probably damaging	1.00
R2098:Cdhr2	UTSW	13	54715644	missense	probably benign	0.15
R2135:Cdhr2	UTSW	13	54720947	missense	probably damaging	1.00
R2365:Cdhr2	UTSW	13	54718088	missense	probably benign	0.01
R3693:Cdhr2	UTSW	13	54726416	missense	probably damaging	1.00
R3968:Cdhr2	UTSW	13	54726458	missense	probably damaging	1.00
R4001:Cdhr2	UTSW	13	54718266	missense	probably benign	0.09
R4003:Cdhr2	UTSW	13	54718266	missense	probably benign	0.09
R4030:Cdhr2	UTSW	13	54717861	missense	probably damaging	1.00
R4088:Cdhr2	UTSW	13	54717888	missense	probably null	0.97
R4256:Cdhr2	UTSW	13	54714005	missense	probably damaging	0.99
R4322:Cdhr2	UTSW	13	54733721	missense	probably benign	0.00
R4396:Cdhr2	UTSW	13	54715665	missense	probably damaging	0.99
R4591:Cdhr2	UTSW	13	54715684	missense	probably benign	0.18
R4726:Cdhr2	UTSW	13	54718539	missense	probably damaging	0.99
R5370:Cdhr2	UTSW	13	54720887	missense	probably damaging	1.00
R5396:Cdhr2	UTSW	13	54736456	missense	probably benign
R5447:Cdhr2	UTSW	13	54733250	missense	probably damaging	1.00
R5654:Cdhr2	UTSW	13	54736536	missense	probably benign
R5727:Cdhr2	UTSW	13	54724308	missense	possibly damaging	0.95
R5771:Cdhr2	UTSW	13	54726695	missense	probably damaging	0.99
R5924:Cdhr2	UTSW	13	54726683	missense	probably benign	0.01
R5928:Cdhr2	UTSW	13	54734019	missense	probably benign	0.01
R6246:Cdhr2	UTSW	13	54719710	missense	probably damaging	1.00
R6351:Cdhr2	UTSW	13	54726776	missense	probably benign	0.16
R6358:Cdhr2	UTSW	13	54736546	missense	probably damaging	0.99
R6433:Cdhr2	UTSW	13	54718512	missense	probably damaging	0.97
R7044:Cdhr2	UTSW	13	54733321	nonsense	probably null
R7341:Cdhr2	UTSW	13	54719492	missense	probably damaging	0.99
R7462:Cdhr2	UTSW	13	54726739	missense	probably damaging	1.00
R7488:Cdhr2	UTSW	13	54717915	missense	probably benign	0.28
R7763:Cdhr2	UTSW	13	54717692	missense	probably damaging	1.00
R7771:Cdhr2	UTSW	13	54718275	missense	probably damaging	1.00
R8050:Cdhr2	UTSW	13	54734222	missense	probably damaging	0.96
R8069:Cdhr2	UTSW	13	54731070	missense	probably damaging	1.00
R8070:Cdhr2	UTSW	13	54719793	missense	probably benign	0.13
R8129:Cdhr2	UTSW	13	54716395	splice site	probably null
Z1177:Cdhr2	UTSW	13	54715671	missense	probably damaging	1.00
Z1177:Cdhr2	UTSW	13	54718564	missense	probably damaging	1.00
Z1177:Cdhr2	UTSW	13	54726408	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AAGCTCTGTCCTCTGTCCACAG -3'
(R):5'- GTATCCACATCCTGGGCTATC -3'

Sequencing Primer
(F):5'- TCCTCTGTCCACAGGAGCATG -3'
(R):5'- TATCACCCGAGTCACCTGG -3'

Posted On

2015-04-29