Mutagenetix > Incidental Mutations

Incidental Mutation 'R3970:Pcdh8'

310940

Institutional Source

Beutler Lab

Gene Symbol

Pcdh8

Ensembl Gene

ENSMUSG00000036422

Gene Name

protocadherin 8

Synonyms

1700080P15Rik, Papc

MMRRC Submission

040938-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3970 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

79766775-79771312 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 79770266 bp

Zygosity

Heterozygous

Amino Acid Change

Glycine to Serine at position 286 (G286S)

Ref Sequence

ENSEMBL: ENSMUSP00000141417 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039568] [ENSMUST00000195355]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000039568
AA Change: G286S

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000045333
Gene: ENSMUSG00000036422
AA Change: G286S

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
CA	45	133	8.69e-2	SMART
CA	157	243	1.22e-14	SMART
CA	268	352	6.08e-24	SMART
low complexity region	360	392	N/A	INTRINSIC
CA	414	495	5.34e-20	SMART
CA	519	607	1.57e-26	SMART
CA	636	718	1.12e-4	SMART
transmembrane domain	748	770	N/A	INTRINSIC
low complexity region	782	802	N/A	INTRINSIC
low complexity region	828	860	N/A	INTRINSIC
low complexity region	910	933	N/A	INTRINSIC
low complexity region	974	980	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000193759

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194214

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194881

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195034

Predicted Effect

possibly damaging
Transcript: ENSMUST00000195355
AA Change: G286S

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000141417
Gene: ENSMUSG00000036422
AA Change: G286S

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
CA	45	133	8.69e-2	SMART
CA	157	243	1.22e-14	SMART
CA	268	352	6.08e-24	SMART
low complexity region	360	392	N/A	INTRINSIC
CA	414	495	5.34e-20	SMART
CA	519	607	1.57e-26	SMART
CA	636	718	1.12e-4	SMART
transmembrane domain	748	770	N/A	INTRINSIC
low complexity region	813	836	N/A	INTRINSIC
low complexity region	877	883	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.4%

Validation Efficiency

96% (53/55)

MGI Phenotype

FUNCTION: This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. The gene encodes a type I transmembrane protein composed of an extracellular domain including 6 cadherin ectodomains, a single-pass transmembrane domain and a cytoplasmic tail. Unlike classical cadherins, which are generally encoded by 15-17 exons, this gene includes only 3 exons with the first large exon encoding the extracellular and transmembrane region. Although this gene product is capable of homophilic interaction, it appears to affect cell-cell adhesion indirectly by initiating signaling events that regulate classical cadherin-mediated adhesion. Based on studies on this protein and its orthologs, this protocadherin mainly functions in developing embryos and the central nervous system, but can also function as a tumor suppressor. Alternative splicing yielding isoforms with unique cytoplasmic tails has been reported. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous null mice are viable and fertile, and do not exhibit any gross skeletal defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2510039O18Rik	T	C	4: 147,945,322	M583T	probably damaging	Het
Actn4	T	C	7: 28,962,032	K51R	probably benign	Het
Adamts15	T	C	9: 30,910,602	Y513C	probably benign	Het
Akap13	T	A	7: 75,569,951	L34*	probably null	Het
Akap6	A	T	12: 53,141,453	K1883N	probably damaging	Het
Ano1	T	C	7: 144,607,963	N749D	probably benign	Het
Armcx6	G	T	X: 134,749,756	H109N	possibly damaging	Het
Camk4	T	A	18: 33,179,581	I258N	possibly damaging	Het
Cdhr2	A	T	13: 54,726,458	N781I	probably damaging	Het
Cherp	T	C	8: 72,469,951	H196R	possibly damaging	Het
Chia1	T	G	3: 106,121,635		probably null	Het
Col11a1	A	T	3: 114,097,189	T392S	unknown	Het
Commd9	C	A	2: 101,897,141	N93K	probably benign	Het
Csf2rb	T	C	15: 78,341,467	V286A	probably benign	Het
Dnah17	G	A	11: 118,041,158		probably benign	Het
E2f1	C	G	2: 154,564,022	G144R	probably damaging	Het
Fam196b	A	T	11: 34,419,739	Q481L	probably damaging	Het
Fcho2	A	T	13: 98,735,056	S551T	probably benign	Het
Flna	A	T	X: 74,235,667	V1253E	probably damaging	Het
Gm12185	A	T	11: 48,907,345	C774S	probably benign	Het
Gm14401	T	C	2: 177,086,996	Y292H	possibly damaging	Het
Kif5c	A	G	2: 49,688,744	E128G	probably damaging	Het
Lama3	A	T	18: 12,580,341	K3230M	probably damaging	Het
Myof	C	T	19: 37,901,263	V1287M	probably damaging	Het
Myof	T	G	19: 38,022,610	D60A	possibly damaging	Het
Myrf	A	G	19: 10,223,237	L332P	probably damaging	Het
Nampt	T	A	12: 32,833,096	D93E	probably benign	Het
Narf	A	T	11: 121,238,421	E10D	possibly damaging	Het
Nlrp6	C	A	7: 140,921,655	A45E	probably damaging	Het
Obscn	G	A	11: 59,051,662	P4898L	probably damaging	Het
Olfr251	T	C	9: 38,377,926	V15A	probably damaging	Het
Pabpc5	A	G	X: 119,928,624	E212G	probably benign	Het
Pcdha2	C	A	18: 36,940,697	Y460*	probably null	Het
Pcdhga4	G	T	18: 37,687,601	L734F	possibly damaging	Het
Pecr	G	A	1: 72,276,309	T94I	probably damaging	Het
Piezo2	A	T	18: 63,011,696	V2776E	probably damaging	Het
Pign	A	C	1: 105,656,003	S125A	probably damaging	Het
Pik3r2	G	A	8: 70,770,421	R452C	probably benign	Het
Pkd1l1	C	T	11: 8,874,218	E1566K	probably damaging	Het
Plcb2	A	G	2: 118,715,690		probably benign	Het
Ppl	T	C	16: 5,100,332		probably null	Het
Pramel4	A	T	4: 144,068,474	N477I	possibly damaging	Het
Psd	C	T	19: 46,324,406	R175H	probably benign	Het
Sema3g	T	C	14: 31,226,521		probably null	Het
Sf3b1	G	A	1: 55,012,182	R196*	probably null	Het
Slc26a4	G	T	12: 31,528,687	H656N	probably damaging	Het
Slc6a7	A	C	18: 61,003,345	L328R	possibly damaging	Het
Stab2	T	C	10: 86,878,886	T139A	probably damaging	Het
Tiam2	T	A	17: 3,428,831	I613N	probably damaging	Het
Tlk1	A	G	2: 70,716,652	V695A	probably damaging	Het
Trpc2	A	G	7: 102,084,324	D160G	probably damaging	Het
Uhrf2	T	C	19: 30,079,915	V491A	probably damaging	Het
Vwa7	G	A	17: 35,017,708	A84T	probably damaging	Het
Zfp219	T	A	14: 52,006,964	Q541L	probably benign	Het

Other mutations in Pcdh8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02127:Pcdh8	APN	14	79769246	missense	probably damaging	0.99
IGL02611:Pcdh8	APN	14	79767667	missense	probably benign	0.00
R0094:Pcdh8	UTSW	14	79768148	missense	probably damaging	1.00
R0118:Pcdh8	UTSW	14	79767408	missense	probably damaging	1.00
R0558:Pcdh8	UTSW	14	79770076	missense	probably damaging	1.00
R0681:Pcdh8	UTSW	14	79769960	missense	probably benign
R0718:Pcdh8	UTSW	14	79770691	missense	possibly damaging	0.49
R1281:Pcdh8	UTSW	14	79767726	missense	probably damaging	1.00
R1487:Pcdh8	UTSW	14	79769547	missense	probably damaging	1.00
R1511:Pcdh8	UTSW	14	79769389	missense	possibly damaging	0.46
R1552:Pcdh8	UTSW	14	79770607	missense	probably benign	0.20
R1556:Pcdh8	UTSW	14	79770403	missense	probably damaging	1.00
R1659:Pcdh8	UTSW	14	79768134	missense	probably damaging	1.00
R2062:Pcdh8	UTSW	14	79768211	missense	probably damaging	1.00
R2063:Pcdh8	UTSW	14	79768211	missense	probably damaging	1.00
R2068:Pcdh8	UTSW	14	79768211	missense	probably damaging	1.00
R2920:Pcdh8	UTSW	14	79768714	missense	possibly damaging	0.88
R4113:Pcdh8	UTSW	14	79767513	missense	probably damaging	1.00
R4771:Pcdh8	UTSW	14	79768270	missense	possibly damaging	0.48
R4840:Pcdh8	UTSW	14	79770868	missense	possibly damaging	0.67
R5169:Pcdh8	UTSW	14	79767655	missense	probably benign	0.09
R5187:Pcdh8	UTSW	14	79770154	missense	probably damaging	0.99
R5415:Pcdh8	UTSW	14	79770248	nonsense	probably null
R5548:Pcdh8	UTSW	14	79767502	missense	probably damaging	1.00
R5749:Pcdh8	UTSW	14	79770085	missense	probably damaging	1.00
R5778:Pcdh8	UTSW	14	79770757	missense	probably damaging	1.00
R5795:Pcdh8	UTSW	14	79770980	missense	possibly damaging	0.95
R6313:Pcdh8	UTSW	14	79767651	missense	probably benign	0.02
R7472:Pcdh8	UTSW	14	79771251	splice site	probably null
R7540:Pcdh8	UTSW	14	79771103	missense	probably benign
R7653:Pcdh8	UTSW	14	79767646	missense	probably benign	0.01
R7751:Pcdh8	UTSW	14	79770703	missense	probably damaging	0.96
R7836:Pcdh8	UTSW	14	79768661	missense	possibly damaging	0.73
R8281:Pcdh8	UTSW	14	79769479	missense	probably damaging	0.98
R8365:Pcdh8	UTSW	14	79770986	missense	probably damaging	1.00
Z1176:Pcdh8	UTSW	14	79769077	missense	probably benign	0.01
Z1177:Pcdh8	UTSW	14	79769881	missense	probably benign	0.14

Predicted Primers

PCR Primer
(F):5'- TAGAAATTTCAGGAGCGTTGTCG -3'
(R):5'- TGCTGCTACAGGAGTTGGAC -3'

Sequencing Primer
(F):5'- TCTCGGATGCGCACGATAAC -3'
(R):5'- CTACAGGAGTTGGACCGCGAG -3'

Posted On

2015-04-29