Mutagenetix > Incidental Mutations

Incidental Mutation 'R3970:Tiam2'

310942

Institutional Source

Beutler Lab

Gene Symbol

Tiam2

Ensembl Gene

ENSMUSG00000023800

Gene Name

T cell lymphoma invasion and metastasis 2

Synonyms

3000002F19Rik, STEF

MMRRC Submission

040938-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3970 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

3326573-3531344 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 3428831 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 613 (I613N)

Ref Sequence

ENSEMBL: ENSMUSP00000125842 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072156] [ENSMUST00000169838]

Predicted Effect

probably damaging
Transcript: ENSMUST00000072156
AA Change: I613N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000072020
Gene: ENSMUSG00000023800
AA Change: I613N

Domain	Start	End	E-Value	Type
low complexity region	230	245	N/A	INTRINSIC
low complexity region	267	281	N/A	INTRINSIC
low complexity region	471	492	N/A	INTRINSIC
PH	505	620	7.82e-16	SMART
RBD	831	902	1.32e-26	SMART
PDZ	921	995	2.38e-7	SMART
RhoGEF	1124	1313	2.23e-61	SMART
PH	1347	1478	2.86e0	SMART
low complexity region	1522	1532	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000169838
AA Change: I613N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000125842
Gene: ENSMUSG00000023800
AA Change: I613N

Domain	Start	End	E-Value	Type
low complexity region	230	245	N/A	INTRINSIC
low complexity region	267	281	N/A	INTRINSIC
low complexity region	471	492	N/A	INTRINSIC
PH	505	620	7.82e-16	SMART
RBD	831	902	1.32e-26	SMART
PDZ	921	995	2.38e-7	SMART
RhoGEF	1124	1313	2.23e-61	SMART
PH	1347	1478	2.86e0	SMART
low complexity region	1522	1532	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226905

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.4%

Validation Efficiency

96% (53/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a guanine nucleotide exchange factor. A highly similar mouse protein specifically activates ras-related C3 botulinum substrate 1, converting this Rho-like guanosine triphosphatase (GTPase) from a guanosine diphosphate-bound inactive state to a guanosine triphosphate-bound active state. The encoded protein may play a role in neural cell development. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2510039O18Rik	T	C	4: 147,945,322	M583T	probably damaging	Het
Actn4	T	C	7: 28,962,032	K51R	probably benign	Het
Adamts15	T	C	9: 30,910,602	Y513C	probably benign	Het
Akap13	T	A	7: 75,569,951	L34*	probably null	Het
Akap6	A	T	12: 53,141,453	K1883N	probably damaging	Het
Ano1	T	C	7: 144,607,963	N749D	probably benign	Het
Armcx6	G	T	X: 134,749,756	H109N	possibly damaging	Het
Camk4	T	A	18: 33,179,581	I258N	possibly damaging	Het
Cdhr2	A	T	13: 54,726,458	N781I	probably damaging	Het
Cherp	T	C	8: 72,469,951	H196R	possibly damaging	Het
Chia1	T	G	3: 106,121,635		probably null	Het
Col11a1	A	T	3: 114,097,189	T392S	unknown	Het
Commd9	C	A	2: 101,897,141	N93K	probably benign	Het
Csf2rb	T	C	15: 78,341,467	V286A	probably benign	Het
Dnah17	G	A	11: 118,041,158		probably benign	Het
E2f1	C	G	2: 154,564,022	G144R	probably damaging	Het
Fam196b	A	T	11: 34,419,739	Q481L	probably damaging	Het
Fcho2	A	T	13: 98,735,056	S551T	probably benign	Het
Flna	A	T	X: 74,235,667	V1253E	probably damaging	Het
Gm12185	A	T	11: 48,907,345	C774S	probably benign	Het
Gm14401	T	C	2: 177,086,996	Y292H	possibly damaging	Het
Kif5c	A	G	2: 49,688,744	E128G	probably damaging	Het
Lama3	A	T	18: 12,580,341	K3230M	probably damaging	Het
Myof	T	G	19: 38,022,610	D60A	possibly damaging	Het
Myof	C	T	19: 37,901,263	V1287M	probably damaging	Het
Myrf	A	G	19: 10,223,237	L332P	probably damaging	Het
Nampt	T	A	12: 32,833,096	D93E	probably benign	Het
Narf	A	T	11: 121,238,421	E10D	possibly damaging	Het
Nlrp6	C	A	7: 140,921,655	A45E	probably damaging	Het
Obscn	G	A	11: 59,051,662	P4898L	probably damaging	Het
Olfr251	T	C	9: 38,377,926	V15A	probably damaging	Het
Pabpc5	A	G	X: 119,928,624	E212G	probably benign	Het
Pcdh8	C	T	14: 79,770,266	G286S	possibly damaging	Het
Pcdha2	C	A	18: 36,940,697	Y460*	probably null	Het
Pcdhga4	G	T	18: 37,687,601	L734F	possibly damaging	Het
Pecr	G	A	1: 72,276,309	T94I	probably damaging	Het
Piezo2	A	T	18: 63,011,696	V2776E	probably damaging	Het
Pign	A	C	1: 105,656,003	S125A	probably damaging	Het
Pik3r2	G	A	8: 70,770,421	R452C	probably benign	Het
Pkd1l1	C	T	11: 8,874,218	E1566K	probably damaging	Het
Plcb2	A	G	2: 118,715,690		probably benign	Het
Ppl	T	C	16: 5,100,332		probably null	Het
Pramel4	A	T	4: 144,068,474	N477I	possibly damaging	Het
Psd	C	T	19: 46,324,406	R175H	probably benign	Het
Sema3g	T	C	14: 31,226,521		probably null	Het
Sf3b1	G	A	1: 55,012,182	R196*	probably null	Het
Slc26a4	G	T	12: 31,528,687	H656N	probably damaging	Het
Slc6a7	A	C	18: 61,003,345	L328R	possibly damaging	Het
Stab2	T	C	10: 86,878,886	T139A	probably damaging	Het
Tlk1	A	G	2: 70,716,652	V695A	probably damaging	Het
Trpc2	A	G	7: 102,084,324	D160G	probably damaging	Het
Uhrf2	T	C	19: 30,079,915	V491A	probably damaging	Het
Vwa7	G	A	17: 35,017,708	A84T	probably damaging	Het
Zfp219	T	A	14: 52,006,964	Q541L	probably benign	Het

Other mutations in Tiam2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01011:Tiam2	APN	17	3415028	missense	probably benign	0.21
IGL01320:Tiam2	APN	17	3505745	missense	probably damaging	1.00
IGL01384:Tiam2	APN	17	3427202	missense	probably benign	0.08
IGL01575:Tiam2	APN	17	3454316	missense	probably damaging	1.00
IGL01769:Tiam2	APN	17	3427290	missense	probably damaging	1.00
IGL02395:Tiam2	APN	17	3421481	missense	possibly damaging	0.49
IGL02652:Tiam2	APN	17	3439696	splice site	probably benign
IGL03102:Tiam2	APN	17	3509548	missense	probably damaging	1.00
IGL03222:Tiam2	APN	17	3438708	missense	probably damaging	0.97
Feste_burg	UTSW	17	3414622	frame shift	probably null
R0257:Tiam2	UTSW	17	3450813	missense	possibly damaging	0.49
R0420:Tiam2	UTSW	17	3502918	missense	probably benign	0.01
R0528:Tiam2	UTSW	17	3511071	missense	probably damaging	1.00
R0532:Tiam2	UTSW	17	3421646	missense	probably damaging	1.00
R0551:Tiam2	UTSW	17	3428954	missense	probably damaging	1.00
R0554:Tiam2	UTSW	17	3438681	nonsense	probably null
R0645:Tiam2	UTSW	17	3514698	missense	possibly damaging	0.92
R0726:Tiam2	UTSW	17	3512833	unclassified	probably benign
R1139:Tiam2	UTSW	17	3477267	missense	possibly damaging	0.55
R1392:Tiam2	UTSW	17	3414197	missense	possibly damaging	0.71
R1392:Tiam2	UTSW	17	3414197	missense	possibly damaging	0.71
R1529:Tiam2	UTSW	17	3516703	missense	probably benign	0.00
R1671:Tiam2	UTSW	17	3506834	missense	probably damaging	1.00
R1731:Tiam2	UTSW	17	3518423	missense	probably damaging	0.98
R1759:Tiam2	UTSW	17	3516003	missense	probably damaging	0.98
R1850:Tiam2	UTSW	17	3437235	missense	probably damaging	1.00
R1853:Tiam2	UTSW	17	3415135	missense	probably damaging	1.00
R1855:Tiam2	UTSW	17	3415135	missense	probably damaging	1.00
R1931:Tiam2	UTSW	17	3514725	missense	possibly damaging	0.68
R1932:Tiam2	UTSW	17	3514725	missense	possibly damaging	0.68
R1993:Tiam2	UTSW	17	3415126	nonsense	probably null
R2211:Tiam2	UTSW	17	3414918	nonsense	probably null
R2217:Tiam2	UTSW	17	3415114	missense	probably benign	0.34
R2278:Tiam2	UTSW	17	3427220	missense	probably damaging	0.96
R2407:Tiam2	UTSW	17	3477261	missense	probably benign	0.14
R2516:Tiam2	UTSW	17	3453382	missense	probably damaging	1.00
R2991:Tiam2	UTSW	17	3518250	missense	probably benign
R3086:Tiam2	UTSW	17	3421582	missense	probably damaging	1.00
R3121:Tiam2	UTSW	17	3439702	missense	probably benign	0.01
R3686:Tiam2	UTSW	17	3421684	missense	possibly damaging	0.87
R3740:Tiam2	UTSW	17	3414113	missense	possibly damaging	0.54
R3742:Tiam2	UTSW	17	3414113	missense	possibly damaging	0.54
R3826:Tiam2	UTSW	17	3507701	splice site	probably benign
R3829:Tiam2	UTSW	17	3507701	splice site	probably benign
R3844:Tiam2	UTSW	17	3421651	missense	probably damaging	0.98
R4060:Tiam2	UTSW	17	3428980	missense	probably benign	0.00
R4296:Tiam2	UTSW	17	3450845	missense	probably benign
R4357:Tiam2	UTSW	17	3450853	missense	probably damaging	1.00
R4368:Tiam2	UTSW	17	3414683	missense	probably benign	0.01
R4369:Tiam2	UTSW	17	3413967	start gained	probably benign
R4524:Tiam2	UTSW	17	3514711	missense	probably damaging	1.00
R4619:Tiam2	UTSW	17	3518342	missense	probably damaging	1.00
R4715:Tiam2	UTSW	17	3454168	missense	probably damaging	1.00
R4723:Tiam2	UTSW	17	3450317	missense	probably benign	0.00
R4979:Tiam2	UTSW	17	3505710	missense	probably damaging	1.00
R5182:Tiam2	UTSW	17	3438721	missense	probably damaging	1.00
R5451:Tiam2	UTSW	17	3428996	missense	probably damaging	1.00
R5728:Tiam2	UTSW	17	3414956	missense	probably damaging	0.99
R5827:Tiam2	UTSW	17	3448489	missense	probably benign	0.00
R5879:Tiam2	UTSW	17	3437265	missense	probably damaging	1.00
R5960:Tiam2	UTSW	17	3438640	missense	probably benign	0.24
R5974:Tiam2	UTSW	17	3414809	missense	possibly damaging	0.51
R6198:Tiam2	UTSW	17	3414121	missense	probably benign	0.06
R6222:Tiam2	UTSW	17	3453338	missense	probably damaging	0.96
R6295:Tiam2	UTSW	17	3509556	missense	probably damaging	1.00
R6355:Tiam2	UTSW	17	3414622	frame shift	probably null
R6356:Tiam2	UTSW	17	3414622	frame shift	probably null
R6454:Tiam2	UTSW	17	3438663	missense	probably benign	0.00
R6497:Tiam2	UTSW	17	3506827	missense	probably damaging	1.00
R6579:Tiam2	UTSW	17	3414622	frame shift	probably null
R6580:Tiam2	UTSW	17	3414622	frame shift	probably null
R6581:Tiam2	UTSW	17	3414622	frame shift	probably null
R6582:Tiam2	UTSW	17	3414622	frame shift	probably null
R6648:Tiam2	UTSW	17	3506873	missense	probably damaging	1.00
R6705:Tiam2	UTSW	17	3518243	missense	probably benign	0.01
R6758:Tiam2	UTSW	17	3518403	missense	probably benign	0.01
R6836:Tiam2	UTSW	17	3414380	missense	probably benign	0.17
R6924:Tiam2	UTSW	17	3507795	missense	probably damaging	1.00
R6977:Tiam2	UTSW	17	3518659	missense	probably damaging	1.00
R7051:Tiam2	UTSW	17	3448483	missense	probably damaging	0.99
R7151:Tiam2	UTSW	17	3448385	missense	probably benign	0.36
R7214:Tiam2	UTSW	17	3518412	missense	possibly damaging	0.85
R7332:Tiam2	UTSW	17	3453369	missense	probably damaging	1.00
R7334:Tiam2	UTSW	17	3503008	missense	possibly damaging	0.92
R7414:Tiam2	UTSW	17	3414113	missense	possibly damaging	0.54
R7660:Tiam2	UTSW	17	3482605	start codon destroyed	probably null	0.66
R7743:Tiam2	UTSW	17	3518156	missense	possibly damaging	0.53
R7755:Tiam2	UTSW	17	3421316	missense	probably benign	0.01
R7805:Tiam2	UTSW	17	3509410	missense	probably damaging	1.00
R7813:Tiam2	UTSW	17	3437247	missense	probably damaging	1.00
R7842:Tiam2	UTSW	17	3518124	missense	possibly damaging	0.82
R7989:Tiam2	UTSW	17	3518249	nonsense	probably null
R8011:Tiam2	UTSW	17	3448396	missense	possibly damaging	0.92
R8221:Tiam2	UTSW	17	3518585	missense	probably damaging	0.99
R8260:Tiam2	UTSW	17	3518319	missense	possibly damaging	0.94
R8292:Tiam2	UTSW	17	3506867	missense	probably benign	0.01
R8406:Tiam2	UTSW	17	3507790	missense	possibly damaging	0.94
R8424:Tiam2	UTSW	17	3516041	missense	probably damaging	1.00
R8424:Tiam2	UTSW	17	3516042	missense	probably damaging	1.00
R8430:Tiam2	UTSW	17	3518262	missense	probably benign	0.05
R8530:Tiam2	UTSW	17	3450812	missense	probably benign	0.03
X0027:Tiam2	UTSW	17	3414000	start codon destroyed	probably null	1.00
X0060:Tiam2	UTSW	17	3450354	splice site	probably null
X0065:Tiam2	UTSW	17	3505708	missense	probably damaging	1.00
Z1088:Tiam2	UTSW	17	3415019	missense	probably benign	0.01
Z1176:Tiam2	UTSW	17	3505776	missense	probably null	1.00
Z1177:Tiam2	UTSW	17	3427263	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGAACCTGAGCTGGGTGTTTAC -3'
(R):5'- GGTACCTGATTCTCGATGGC -3'

Sequencing Primer
(F):5'- GGGTGTTTACATTTGGGAAACTATAC -3'
(R):5'- GATTCTCGATGGCCTTCCTG -3'

Posted On

2015-04-29