Mutagenetix > Incidental Mutation

Incidental Mutation 'R3970:Piezo2'

310947

Institutional Source

Beutler Lab

Gene Symbol

Piezo2

Ensembl Gene

ENSMUSG00000041482

Gene Name

piezo-type mechanosensitive ion channel component 2

Synonyms

Fam38b, Fam38b2, 9030411M15Rik, Piezo2, 9430028L06Rik

MMRRC Submission

040938-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3970 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

63010213-63387183 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 63011696 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 2776 (V2776E)

Ref Sequence

ENSEMBL: ENSMUSP00000040019 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047480]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000047480
AA Change: V2776E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000040019
Gene: ENSMUSG00000041482
AA Change: V2776E

Domain	Start	End	E-Value	Type
transmembrane domain	13	44	N/A	INTRINSIC
transmembrane domain	59	81	N/A	INTRINSIC
low complexity region	179	194	N/A	INTRINSIC
transmembrane domain	214	236	N/A	INTRINSIC
transmembrane domain	241	260	N/A	INTRINSIC
transmembrane domain	267	289	N/A	INTRINSIC
coiled coil region	455	482	N/A	INTRINSIC
transmembrane domain	504	526	N/A	INTRINSIC
transmembrane domain	539	561	N/A	INTRINSIC
SCOP:d1eq1a_	597	666	4e-3	SMART
transmembrane domain	682	704	N/A	INTRINSIC
transmembrane domain	708	730	N/A	INTRINSIC
internal_repeat_1	740	764	6.01e-5	PROSPERO
low complexity region	772	784	N/A	INTRINSIC
transmembrane domain	791	813	N/A	INTRINSIC
low complexity region	900	921	N/A	INTRINSIC
transmembrane domain	949	971	N/A	INTRINSIC
transmembrane domain	976	993	N/A	INTRINSIC
transmembrane domain	1000	1022	N/A	INTRINSIC
transmembrane domain	1069	1091	N/A	INTRINSIC
transmembrane domain	1130	1152	N/A	INTRINSIC
transmembrane domain	1156	1173	N/A	INTRINSIC
transmembrane domain	1186	1208	N/A	INTRINSIC
transmembrane domain	1234	1256	N/A	INTRINSIC
transmembrane domain	1308	1327	N/A	INTRINSIC
transmembrane domain	1331	1353	N/A	INTRINSIC
Pfam:PIEZO	1383	1617	1.1e-105	PFAM
low complexity region	1807	1823	N/A	INTRINSIC
low complexity region	1836	1860	N/A	INTRINSIC
low complexity region	1863	1878	N/A	INTRINSIC
transmembrane domain	1981	2003	N/A	INTRINSIC
transmembrane domain	2010	2027	N/A	INTRINSIC
internal_repeat_1	2036	2060	6.01e-5	PROSPERO
low complexity region	2167	2199	N/A	INTRINSIC
transmembrane domain	2261	2283	N/A	INTRINSIC
transmembrane domain	2303	2325	N/A	INTRINSIC
transmembrane domain	2332	2354	N/A	INTRINSIC
transmembrane domain	2364	2386	N/A	INTRINSIC
Pfam:Piezo_RRas_bdg	2412	2821	2.8e-161	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000137141

SMART Domains

Protein: ENSMUSP00000117107
Gene: ENSMUSG00000041482

Domain	Start	End	E-Value	Type
low complexity region	3	22	N/A	INTRINSIC
transmembrane domain	84	106	N/A	INTRINSIC
transmembrane domain	126	148	N/A	INTRINSIC
transmembrane domain	155	177	N/A	INTRINSIC
transmembrane domain	187	209	N/A	INTRINSIC
Pfam:Piezo_RRas_bdg	235	409	4.6e-78	PFAM

Meta Mutation Damage Score

0.5299

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.4%

Validation Efficiency

96% (53/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains more than thirty transmembrane domains and likely functions as part of mechanically-activated (MA) cation channels. These channels serve to connect mechanical forces to biological signals. The encoded protein quickly adapts MA currents in somatosensory neurons. Defects in this gene are a cause of type 5 distal arthrogryposis. Several alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2014]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2510039O18Rik	T	C	4: 147,945,322 (GRCm38)	M583T	probably damaging	Het
Actn4	T	C	7: 28,962,032 (GRCm38)	K51R	probably benign	Het
Adamts15	T	C	9: 30,910,602 (GRCm38)	Y513C	probably benign	Het
Akap13	T	A	7: 75,569,951 (GRCm38)	L34*	probably null	Het
Akap6	A	T	12: 53,141,453 (GRCm38)	K1883N	probably damaging	Het
Ano1	T	C	7: 144,607,963 (GRCm38)	N749D	probably benign	Het
Armcx6	G	T	X: 134,749,756 (GRCm38)	H109N	possibly damaging	Het
Camk4	T	A	18: 33,179,581 (GRCm38)	I258N	possibly damaging	Het
Cdhr2	A	T	13: 54,726,458 (GRCm38)	N781I	probably damaging	Het
Cherp	T	C	8: 72,469,951 (GRCm38)	H196R	possibly damaging	Het
Chia1	T	G	3: 106,121,635 (GRCm38)		probably null	Het
Col11a1	A	T	3: 114,097,189 (GRCm38)	T392S	unknown	Het
Commd9	C	A	2: 101,897,141 (GRCm38)	N93K	probably benign	Het
Csf2rb	T	C	15: 78,341,467 (GRCm38)	V286A	probably benign	Het
Dnah17	G	A	11: 118,041,158 (GRCm38)		probably benign	Het
E2f1	C	G	2: 154,564,022 (GRCm38)	G144R	probably damaging	Het
Fcho2	A	T	13: 98,735,056 (GRCm38)	S551T	probably benign	Het
Flna	A	T	X: 74,235,667 (GRCm38)	V1253E	probably damaging	Het
Gm12185	A	T	11: 48,907,345 (GRCm38)	C774S	probably benign	Het
Gm14401	T	C	2: 177,086,996 (GRCm38)	Y292H	possibly damaging	Het
Insyn2b	A	T	11: 34,419,739 (GRCm38)	Q481L	probably damaging	Het
Kif5c	A	G	2: 49,688,744 (GRCm38)	E128G	probably damaging	Het
Lama3	A	T	18: 12,580,341 (GRCm38)	K3230M	probably damaging	Het
Myof	T	G	19: 38,022,610 (GRCm38)	D60A	possibly damaging	Het
Myof	C	T	19: 37,901,263 (GRCm38)	V1287M	probably damaging	Het
Myrf	A	G	19: 10,223,237 (GRCm38)	L332P	probably damaging	Het
Nampt	T	A	12: 32,833,096 (GRCm38)	D93E	probably benign	Het
Narf	A	T	11: 121,238,421 (GRCm38)	E10D	possibly damaging	Het
Nlrp6	C	A	7: 140,921,655 (GRCm38)	A45E	probably damaging	Het
Obscn	G	A	11: 59,051,662 (GRCm38)	P4898L	probably damaging	Het
Or8c11	T	C	9: 38,377,926 (GRCm38)	V15A	probably damaging	Het
Pabpc5	A	G	X: 119,928,624 (GRCm38)	E212G	probably benign	Het
Pcdh8	C	T	14: 79,770,266 (GRCm38)	G286S	possibly damaging	Het
Pcdha2	C	A	18: 36,940,697 (GRCm38)	Y460*	probably null	Het
Pcdhga4	G	T	18: 37,687,601 (GRCm38)	L734F	possibly damaging	Het
Pecr	G	A	1: 72,276,309 (GRCm38)	T94I	probably damaging	Het
Pign	A	C	1: 105,656,003 (GRCm38)	S125A	probably damaging	Het
Pik3r2	G	A	8: 70,770,421 (GRCm38)	R452C	probably benign	Het
Pkd1l1	C	T	11: 8,874,218 (GRCm38)	E1566K	probably damaging	Het
Plcb2	A	G	2: 118,715,690 (GRCm38)		probably benign	Het
Ppl	T	C	16: 5,100,332 (GRCm38)		probably null	Het
Pramel4	A	T	4: 144,068,474 (GRCm38)	N477I	possibly damaging	Het
Psd	C	T	19: 46,324,406 (GRCm38)	R175H	probably benign	Het
Sema3g	T	C	14: 31,226,521 (GRCm38)		probably null	Het
Sf3b1	G	A	1: 55,012,182 (GRCm38)	R196*	probably null	Het
Slc26a4	G	T	12: 31,528,687 (GRCm38)	H656N	probably damaging	Het
Slc6a7	A	C	18: 61,003,345 (GRCm38)	L328R	possibly damaging	Het
Stab2	T	C	10: 86,878,886 (GRCm38)	T139A	probably damaging	Het
Tiam2	T	A	17: 3,428,831 (GRCm38)	I613N	probably damaging	Het
Tlk1	A	G	2: 70,716,652 (GRCm38)	V695A	probably damaging	Het
Trpc2	A	G	7: 102,084,324 (GRCm38)	D160G	probably damaging	Het
Uhrf2	T	C	19: 30,079,915 (GRCm38)	V491A	probably damaging	Het
Vwa7	G	A	17: 35,017,708 (GRCm38)	A84T	probably damaging	Het
Zfp219	T	A	14: 52,006,964 (GRCm38)	Q541L	probably benign	Het

Other mutations in Piezo2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01360:Piezo2	APN	18	63,117,699 (GRCm38)	missense	probably damaging	1.00
IGL01370:Piezo2	APN	18	63,022,460 (GRCm38)	missense	probably damaging	1.00
IGL01543:Piezo2	APN	18	63,070,030 (GRCm38)	missense	probably damaging	1.00
IGL01561:Piezo2	APN	18	63,124,614 (GRCm38)	missense	probably benign	0.03
IGL01568:Piezo2	APN	18	63,030,392 (GRCm38)	missense	probably benign	0.28
IGL01653:Piezo2	APN	18	63,182,833 (GRCm38)	splice site	probably benign
IGL01674:Piezo2	APN	18	63,027,559 (GRCm38)	missense	probably damaging	1.00
IGL01684:Piezo2	APN	18	63,083,170 (GRCm38)	missense	probably damaging	1.00
IGL01744:Piezo2	APN	18	63,042,788 (GRCm38)	missense	probably damaging	1.00
IGL01859:Piezo2	APN	18	63,092,844 (GRCm38)	missense	probably benign	0.10
IGL02183:Piezo2	APN	18	63,020,634 (GRCm38)	missense	probably benign	0.00
IGL02407:Piezo2	APN	18	63,146,844 (GRCm38)	missense	probably damaging	1.00
IGL02441:Piezo2	APN	18	63,072,862 (GRCm38)	missense	probably damaging	1.00
IGL02542:Piezo2	APN	18	63,032,924 (GRCm38)	missense	probably damaging	0.96
IGL02652:Piezo2	APN	18	63,024,475 (GRCm38)	missense	probably damaging	1.00
IGL02710:Piezo2	APN	18	63,074,659 (GRCm38)	missense	probably damaging	1.00
IGL02850:Piezo2	APN	18	63,020,633 (GRCm38)	missense	probably benign	0.18
IGL02851:Piezo2	APN	18	63,020,633 (GRCm38)	missense	probably benign	0.18
IGL02972:Piezo2	APN	18	63,064,785 (GRCm38)	splice site	probably benign
IGL03011:Piezo2	APN	18	63,124,660 (GRCm38)	missense	probably benign	0.03
IGL03078:Piezo2	APN	18	63,070,075 (GRCm38)	missense	probably damaging	1.00
IGL03114:Piezo2	APN	18	63,030,272 (GRCm38)	splice site	probably null
IGL03129:Piezo2	APN	18	63,114,972 (GRCm38)	missense	probably benign
IGL03143:Piezo2	APN	18	63,108,076 (GRCm38)	missense	probably damaging	0.99
IGL03202:Piezo2	APN	18	63,011,598 (GRCm38)	missense	probably damaging	1.00
IGL03227:Piezo2	APN	18	63,124,606 (GRCm38)	missense	probably damaging	1.00
IGL03228:Piezo2	APN	18	63,053,062 (GRCm38)	missense	probably damaging	1.00
IGL03230:Piezo2	APN	18	63,041,720 (GRCm38)	missense	probably damaging	1.00
IGL03242:Piezo2	APN	18	63,011,538 (GRCm38)	utr 3 prime	probably benign
IGL03291:Piezo2	APN	18	63,021,308 (GRCm38)	missense	probably damaging	1.00
IGL03301:Piezo2	APN	18	63,027,704 (GRCm38)	missense	probably damaging	1.00
Piccolo	UTSW	18	63,011,696 (GRCm38)	missense	probably damaging	1.00
sopranino	UTSW	18	63,024,466 (GRCm38)	missense	probably damaging	1.00
woodwind	UTSW	18	63,124,642 (GRCm38)	missense	possibly damaging	0.50
P0023:Piezo2	UTSW	18	63,386,200 (GRCm38)	splice site	probably benign
PIT4802001:Piezo2	UTSW	18	63,024,469 (GRCm38)	missense	probably damaging	1.00
R0070:Piezo2	UTSW	18	63,102,084 (GRCm38)	missense	probably damaging	1.00
R0416:Piezo2	UTSW	18	63,024,491 (GRCm38)	missense	probably damaging	1.00
R0486:Piezo2	UTSW	18	63,029,061 (GRCm38)	missense	probably damaging	1.00
R0498:Piezo2	UTSW	18	63,102,174 (GRCm38)	missense	possibly damaging	0.87
R0504:Piezo2	UTSW	18	63,024,451 (GRCm38)	missense	probably damaging	1.00
R0506:Piezo2	UTSW	18	63,027,544 (GRCm38)	missense	probably damaging	1.00
R0523:Piezo2	UTSW	18	63,022,481 (GRCm38)	missense	probably damaging	1.00
R0587:Piezo2	UTSW	18	63,022,426 (GRCm38)	missense	possibly damaging	0.82
R0626:Piezo2	UTSW	18	63,019,258 (GRCm38)	missense	probably damaging	0.97
R0734:Piezo2	UTSW	18	63,041,723 (GRCm38)	missense	probably damaging	1.00
R0784:Piezo2	UTSW	18	63,083,235 (GRCm38)	missense	probably damaging	1.00
R0973:Piezo2	UTSW	18	63,015,802 (GRCm38)	missense	probably damaging	1.00
R1183:Piezo2	UTSW	18	63,086,753 (GRCm38)	missense	probably damaging	1.00
R1344:Piezo2	UTSW	18	63,021,254 (GRCm38)	missense	probably damaging	1.00
R1474:Piezo2	UTSW	18	63,083,131 (GRCm38)	missense	probably damaging	1.00
R1571:Piezo2	UTSW	18	63,144,919 (GRCm38)	missense	possibly damaging	0.67
R1643:Piezo2	UTSW	18	63,082,915 (GRCm38)	missense	probably benign	0.03
R1649:Piezo2	UTSW	18	63,117,672 (GRCm38)	missense	probably benign	0.34
R1741:Piezo2	UTSW	18	63,021,173 (GRCm38)	missense	probably damaging	1.00
R1764:Piezo2	UTSW	18	63,124,642 (GRCm38)	missense	possibly damaging	0.50
R1793:Piezo2	UTSW	18	63,106,284 (GRCm38)	missense	possibly damaging	0.78
R1799:Piezo2	UTSW	18	63,108,087 (GRCm38)	missense	probably damaging	1.00
R1799:Piezo2	UTSW	18	63,032,840 (GRCm38)	critical splice donor site	probably null
R1868:Piezo2	UTSW	18	63,019,344 (GRCm38)	missense	probably damaging	1.00
R1879:Piezo2	UTSW	18	63,113,960 (GRCm38)	missense	probably damaging	1.00
R1962:Piezo2	UTSW	18	63,078,840 (GRCm38)	missense	probably damaging	0.98
R1990:Piezo2	UTSW	18	63,074,662 (GRCm38)	missense	probably null	1.00
R1991:Piezo2	UTSW	18	63,074,662 (GRCm38)	missense	probably null	1.00
R1992:Piezo2	UTSW	18	63,074,662 (GRCm38)	missense	probably null	1.00
R1995:Piezo2	UTSW	18	63,078,781 (GRCm38)	missense	probably damaging	1.00
R2004:Piezo2	UTSW	18	63,144,926 (GRCm38)	missense	probably damaging	1.00
R2011:Piezo2	UTSW	18	63,059,744 (GRCm38)	missense	probably damaging	1.00
R2029:Piezo2	UTSW	18	63,118,935 (GRCm38)	missense	possibly damaging	0.62
R2075:Piezo2	UTSW	18	63,081,734 (GRCm38)	missense	probably damaging	1.00
R2078:Piezo2	UTSW	18	63,117,720 (GRCm38)	missense	probably damaging	0.99
R2152:Piezo2	UTSW	18	63,114,041 (GRCm38)	missense	probably damaging	1.00
R2162:Piezo2	UTSW	18	63,081,662 (GRCm38)	critical splice donor site	probably null
R2183:Piezo2	UTSW	18	63,106,274 (GRCm38)	missense	probably damaging	1.00
R2230:Piezo2	UTSW	18	63,145,072 (GRCm38)	missense	probably damaging	1.00
R2231:Piezo2	UTSW	18	63,145,072 (GRCm38)	missense	probably damaging	1.00
R2406:Piezo2	UTSW	18	63,022,525 (GRCm38)	missense	probably damaging	1.00
R2431:Piezo2	UTSW	18	63,245,624 (GRCm38)	missense	possibly damaging	0.95
R2876:Piezo2	UTSW	18	63,053,035 (GRCm38)	missense	probably damaging	1.00
R2935:Piezo2	UTSW	18	63,146,843 (GRCm38)	missense	probably damaging	1.00
R3004:Piezo2	UTSW	18	63,024,435 (GRCm38)	nonsense	probably null
R3016:Piezo2	UTSW	18	63,042,832 (GRCm38)	missense	probably damaging	1.00
R3794:Piezo2	UTSW	18	63,081,793 (GRCm38)	missense	probably damaging	0.99
R3832:Piezo2	UTSW	18	63,081,662 (GRCm38)	critical splice donor site	probably null
R3833:Piezo2	UTSW	18	63,081,662 (GRCm38)	critical splice donor site	probably null
R3968:Piezo2	UTSW	18	63,011,696 (GRCm38)	missense	probably damaging	1.00
R3969:Piezo2	UTSW	18	63,011,696 (GRCm38)	missense	probably damaging	1.00
R4169:Piezo2	UTSW	18	63,050,604 (GRCm38)	missense	probably benign
R4181:Piezo2	UTSW	18	63,124,730 (GRCm38)	critical splice acceptor site	probably null
R4301:Piezo2	UTSW	18	63,084,840 (GRCm38)	missense	probably damaging	1.00
R4302:Piezo2	UTSW	18	63,124,730 (GRCm38)	critical splice acceptor site	probably null
R4475:Piezo2	UTSW	18	63,102,099 (GRCm38)	missense	probably damaging	1.00
R4493:Piezo2	UTSW	18	63,114,063 (GRCm38)	missense	probably damaging	0.98
R4519:Piezo2	UTSW	18	63,072,880 (GRCm38)	missense	probably damaging	1.00
R4539:Piezo2	UTSW	18	63,086,628 (GRCm38)	missense	probably damaging	1.00
R4687:Piezo2	UTSW	18	63,069,963 (GRCm38)	missense	probably damaging	1.00
R4732:Piezo2	UTSW	18	63,030,401 (GRCm38)	missense	probably damaging	1.00
R4733:Piezo2	UTSW	18	63,030,401 (GRCm38)	missense	probably damaging	1.00
R4825:Piezo2	UTSW	18	63,144,954 (GRCm38)	missense	probably damaging	0.98
R4899:Piezo2	UTSW	18	63,078,791 (GRCm38)	missense	possibly damaging	0.84
R4946:Piezo2	UTSW	18	63,157,262 (GRCm38)	missense	probably benign
R4961:Piezo2	UTSW	18	63,052,961 (GRCm38)	splice site	probably null
R4968:Piezo2	UTSW	18	63,144,971 (GRCm38)	nonsense	probably null
R4973:Piezo2	UTSW	18	63,074,680 (GRCm38)	missense	probably damaging	1.00
R4997:Piezo2	UTSW	18	63,083,113 (GRCm38)	missense	probably damaging	1.00
R5078:Piezo2	UTSW	18	63,024,536 (GRCm38)	missense	probably damaging	1.00
R5134:Piezo2	UTSW	18	63,074,620 (GRCm38)	missense	probably damaging	1.00
R5151:Piezo2	UTSW	18	63,030,409 (GRCm38)	missense	possibly damaging	0.72
R5209:Piezo2	UTSW	18	63,032,929 (GRCm38)	missense	probably damaging	1.00
R5367:Piezo2	UTSW	18	63,064,731 (GRCm38)	missense	probably damaging	1.00
R5401:Piezo2	UTSW	18	63,084,740 (GRCm38)	missense	possibly damaging	0.81
R5464:Piezo2	UTSW	18	63,145,105 (GRCm38)	missense	probably damaging	1.00
R5469:Piezo2	UTSW	18	63,027,864 (GRCm38)	missense	probably damaging	1.00
R5650:Piezo2	UTSW	18	63,011,721 (GRCm38)	missense	probably damaging	1.00
R5654:Piezo2	UTSW	18	63,145,091 (GRCm38)	missense	possibly damaging	0.94
R5677:Piezo2	UTSW	18	63,117,697 (GRCm38)	missense	probably benign	0.25
R5677:Piezo2	UTSW	18	63,117,696 (GRCm38)	missense	possibly damaging	0.94
R5792:Piezo2	UTSW	18	63,146,856 (GRCm38)	missense	probably damaging	1.00
R5874:Piezo2	UTSW	18	63,027,901 (GRCm38)	missense	probably damaging	1.00
R5877:Piezo2	UTSW	18	63,113,934 (GRCm38)	missense	probably benign	0.22
R6036:Piezo2	UTSW	18	63,114,948 (GRCm38)	nonsense	probably null
R6036:Piezo2	UTSW	18	63,114,948 (GRCm38)	nonsense	probably null
R6073:Piezo2	UTSW	18	63,012,645 (GRCm38)	missense	probably damaging	1.00
R6198:Piezo2	UTSW	18	63,157,210 (GRCm38)	nonsense	probably null
R6255:Piezo2	UTSW	18	63,121,270 (GRCm38)	missense	possibly damaging	0.75
R6259:Piezo2	UTSW	18	63,117,678 (GRCm38)	missense	possibly damaging	0.69
R6391:Piezo2	UTSW	18	63,106,293 (GRCm38)	missense	possibly damaging	0.79
R6446:Piezo2	UTSW	18	63,086,607 (GRCm38)	missense	probably damaging	1.00
R6465:Piezo2	UTSW	18	63,041,663 (GRCm38)	missense	possibly damaging	0.82
R6518:Piezo2	UTSW	18	63,106,271 (GRCm38)	missense	probably damaging	0.99
R6521:Piezo2	UTSW	18	63,021,328 (GRCm38)	missense	probably damaging	1.00
R6625:Piezo2	UTSW	18	63,021,262 (GRCm38)	missense	probably damaging	1.00
R6744:Piezo2	UTSW	18	63,032,889 (GRCm38)	nonsense	probably null
R6855:Piezo2	UTSW	18	63,090,879 (GRCm38)	critical splice donor site	probably null
R6927:Piezo2	UTSW	18	63,032,986 (GRCm38)	missense	probably damaging	1.00
R6980:Piezo2	UTSW	18	63,082,961 (GRCm38)	critical splice acceptor site	probably null
R7141:Piezo2	UTSW	18	63,145,110 (GRCm38)	nonsense	probably null
R7162:Piezo2	UTSW	18	63,124,709 (GRCm38)	missense	possibly damaging	0.50
R7331:Piezo2	UTSW	18	63,108,030 (GRCm38)	missense	probably damaging	0.99
R7382:Piezo2	UTSW	18	63,017,519 (GRCm38)	splice site	probably null
R7395:Piezo2	UTSW	18	63,027,563 (GRCm38)	missense	probably damaging	1.00
R7448:Piezo2	UTSW	18	63,024,472 (GRCm38)	missense	probably damaging	1.00
R7465:Piezo2	UTSW	18	63,012,723 (GRCm38)	missense	probably benign
R7517:Piezo2	UTSW	18	63,082,925 (GRCm38)	missense	possibly damaging	0.52
R7577:Piezo2	UTSW	18	63,053,010 (GRCm38)	missense	probably benign	0.01
R7612:Piezo2	UTSW	18	63,042,539 (GRCm38)	missense	probably benign	0.12
R7829:Piezo2	UTSW	18	63,113,876 (GRCm38)	critical splice donor site	probably null
R7835:Piezo2	UTSW	18	63,082,945 (GRCm38)	missense	probably benign	0.12
R8014:Piezo2	UTSW	18	63,083,200 (GRCm38)	missense	probably benign	0.02
R8055:Piezo2	UTSW	18	63,042,811 (GRCm38)	missense	probably damaging	0.99
R8062:Piezo2	UTSW	18	63,030,466 (GRCm38)	missense	possibly damaging	0.87
R8306:Piezo2	UTSW	18	63,075,730 (GRCm38)	missense	probably damaging	1.00
R8332:Piezo2	UTSW	18	63,012,786 (GRCm38)	missense	possibly damaging	0.67
R8355:Piezo2	UTSW	18	63,090,998 (GRCm38)	missense	probably damaging	1.00
R8383:Piezo2	UTSW	18	63,084,688 (GRCm38)	missense	probably damaging	0.97
R8455:Piezo2	UTSW	18	63,090,998 (GRCm38)	missense	probably damaging	1.00
R8501:Piezo2	UTSW	18	63,045,540 (GRCm38)	missense	probably damaging	0.99
R8523:Piezo2	UTSW	18	63,146,802 (GRCm38)	missense	probably damaging	0.99
R8692:Piezo2	UTSW	18	63,092,900 (GRCm38)	nonsense	probably null
R8708:Piezo2	UTSW	18	63,093,015 (GRCm38)	missense	probably damaging	1.00
R8726:Piezo2	UTSW	18	63,109,885 (GRCm38)	missense	probably benign
R8727:Piezo2	UTSW	18	63,109,885 (GRCm38)	missense	probably benign
R8810:Piezo2	UTSW	18	63,114,963 (GRCm38)	missense	probably benign	0.41
R8900:Piezo2	UTSW	18	63,115,025 (GRCm38)	missense	probably benign	0.04
R9037:Piezo2	UTSW	18	63,092,831 (GRCm38)	missense	probably benign	0.31
R9079:Piezo2	UTSW	18	63,024,466 (GRCm38)	missense	probably damaging	1.00
R9090:Piezo2	UTSW	18	63,075,719 (GRCm38)	missense	probably damaging	0.99
R9090:Piezo2	UTSW	18	63,030,379 (GRCm38)	missense	probably damaging	0.99
R9123:Piezo2	UTSW	18	63,045,518 (GRCm38)	missense	probably benign	0.00
R9125:Piezo2	UTSW	18	63,045,518 (GRCm38)	missense	probably benign	0.00
R9171:Piezo2	UTSW	18	63,045,479 (GRCm38)	missense	probably benign	0.04
R9194:Piezo2	UTSW	18	63,117,744 (GRCm38)	missense	probably benign	0.03
R9203:Piezo2	UTSW	18	63,157,231 (GRCm38)	missense	probably benign	0.00
R9209:Piezo2	UTSW	18	63,021,301 (GRCm38)	missense	probably damaging	1.00
R9261:Piezo2	UTSW	18	63,075,797 (GRCm38)	missense	possibly damaging	0.84
R9271:Piezo2	UTSW	18	63,030,379 (GRCm38)	missense	probably damaging	0.99
R9271:Piezo2	UTSW	18	63,075,719 (GRCm38)	missense	probably damaging	0.99
R9283:Piezo2	UTSW	18	63,024,566 (GRCm38)	missense	probably damaging	1.00
R9377:Piezo2	UTSW	18	63,029,085 (GRCm38)	missense	possibly damaging	0.48
R9499:Piezo2	UTSW	18	63,032,962 (GRCm38)	missense	possibly damaging	0.67
R9531:Piezo2	UTSW	18	63,102,165 (GRCm38)	missense	possibly damaging	0.95
R9551:Piezo2	UTSW	18	63,032,962 (GRCm38)	missense	possibly damaging	0.67
R9607:Piezo2	UTSW	18	63,386,276 (GRCm38)	start gained	probably benign
R9608:Piezo2	UTSW	18	63,146,945 (GRCm38)	missense	probably benign	0.09
R9617:Piezo2	UTSW	18	63,115,037 (GRCm38)	missense	probably benign	0.43
R9624:Piezo2	UTSW	18	63,064,696 (GRCm38)	missense	possibly damaging	0.88
X0017:Piezo2	UTSW	18	63,027,586 (GRCm38)	missense	probably damaging	0.99
X0022:Piezo2	UTSW	18	63,050,610 (GRCm38)	missense	probably benign	0.43
X0060:Piezo2	UTSW	18	63,017,577 (GRCm38)	missense	probably benign	0.09
Z1088:Piezo2	UTSW	18	63,069,994 (GRCm38)	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- GCAGTCCAGGTCTTAAGTGATC -3'
(R):5'- TCTCAGGACAGGATTATCAGAGGG -3'

Sequencing Primer
(F):5'- CCAGGTCTTAAGTGATCAGTTTG -3'
(R):5'- CACCTTGTGTTGGATTTTGTCAAAAC -3'

Posted On

2015-04-29