Incidental Mutation 'R3971:Mcoln1'
ID 310972
Institutional Source Beutler Lab
Gene Symbol Mcoln1
Ensembl Gene ENSMUSG00000004567
Gene Name mucolipin 1
Synonyms TRPML1, mucolipidin, 2210015I05Rik
MMRRC Submission 040839-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.167) question?
Stock # R3971 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 3500457-3515232 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 3507408 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Lysine at position 138 (I138K)
Ref Sequence ENSEMBL: ENSMUSP00000004683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004683] [ENSMUST00000160338] [ENSMUST00000208306] [ENSMUST00000208359]
AlphaFold Q99J21
Predicted Effect probably benign
Transcript: ENSMUST00000004683
AA Change: I138K

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000004683
Gene: ENSMUSG00000004567
AA Change: I138K

DomainStartEndE-ValueType
low complexity region 30 39 N/A INTRINSIC
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 299 321 N/A INTRINSIC
transmembrane domain 348 370 N/A INTRINSIC
Pfam:PKD_channel 378 524 2.1e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159538
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159808
Predicted Effect probably benign
Transcript: ENSMUST00000160338
SMART Domains Protein: ENSMUSP00000123717
Gene: ENSMUSG00000004567

DomainStartEndE-ValueType
low complexity region 30 39 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162797
Predicted Effect probably benign
Transcript: ENSMUST00000208306
Predicted Effect probably benign
Transcript: ENSMUST00000208359
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208739
Predicted Effect probably benign
Transcript: ENSMUST00000208943
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 95% (38/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a memberof the transient receptor potential (TRP) cation channel gene family. The transmembrane protein localizes to intracellular vesicular membranes including lysosomes, and functions in the late endocytic pathway and in the regulation of lysosomal exocytosis. The channel is permeable to Ca(2+), Fe(2+), Na(+), K(+), and H(+), and is modulated by changes in Ca(2+) concentration. Mutations in this gene result in mucolipidosis type IV. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit premature death around 8 months of age preceeded by weight loss, weakness, lethargy, bladder and stomach distension, and retinal degradation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T C 7: 118,833,799 I585T probably damaging Het
Aadat C T 8: 60,518,581 P147L probably damaging Het
Apbb1ip T A 2: 22,823,494 D120E unknown Het
Atp10b A G 11: 43,216,512 D791G probably damaging Het
Aunip A G 4: 134,523,469 K242E possibly damaging Het
BC067074 A G 13: 113,317,126 E41G probably damaging Het
Ccdc80 A G 16: 45,095,820 E313G probably benign Het
Cd72 C T 4: 43,449,491 R275H probably damaging Het
Chrnb1 A G 11: 69,792,916 probably benign Het
Coro2b C T 9: 62,429,240 A251T possibly damaging Het
Ddr2 A G 1: 169,988,417 F574L probably damaging Het
Dock1 G A 7: 134,746,908 D284N probably damaging Het
Dync1h1 A G 12: 110,665,965 H4506R probably benign Het
Fam174b T C 7: 73,766,600 V147A probably damaging Het
Glp2r T A 11: 67,746,815 D130V possibly damaging Het
Gm18856 A T 13: 13,964,848 probably benign Het
Gm7247 A G 14: 51,365,384 Y59C probably damaging Het
Hecw1 T C 13: 14,236,929 D1062G probably damaging Het
Ifit2 A G 19: 34,574,041 E327G probably benign Het
Ighv1-37 A T 12: 114,896,459 S43T probably damaging Het
Man2b1 A G 8: 85,085,391 N158S probably damaging Het
Mki67 A C 7: 135,696,130 S2392A probably benign Het
Mrc2 G A 11: 105,328,031 D193N possibly damaging Het
Myo5b C T 18: 74,740,527 L1501F probably damaging Het
Nckap1l A G 15: 103,462,560 K189E probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr816 T C 10: 129,911,873 N135S probably benign Het
Otop1 A G 5: 38,300,189 I431V probably benign Het
Psma8 A G 18: 14,757,387 K195E possibly damaging Het
Rbm25 A G 12: 83,675,208 T723A probably benign Het
Sema3b A G 9: 107,600,368 S485P probably benign Het
Slc12a2 T A 18: 57,930,196 L916Q possibly damaging Het
Spata31d1a T A 13: 59,702,157 D719V possibly damaging Het
Synj1 A G 16: 90,991,603 S86P probably damaging Het
Tmem130 T A 5: 144,755,321 H91L probably benign Het
Tsc2 T C 17: 24,623,588 D288G probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Wac T C 18: 7,916,175 V303A probably damaging Het
Zfhx2 A G 14: 55,074,475 V254A probably benign Het
Zfp993 A G 4: 146,657,632 T138A probably benign Het
Other mutations in Mcoln1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01362:Mcoln1 APN 8 3507558 missense possibly damaging 0.89
IGL01621:Mcoln1 APN 8 3510910 missense probably damaging 1.00
IGL02147:Mcoln1 APN 8 3508379 missense probably benign
IGL02156:Mcoln1 APN 8 3512657 nonsense probably null
R0616:Mcoln1 UTSW 8 3515025 missense probably benign 0.00
R1498:Mcoln1 UTSW 8 3512861 missense probably damaging 1.00
R2102:Mcoln1 UTSW 8 3511731 missense probably damaging 1.00
R2155:Mcoln1 UTSW 8 3511787 missense probably damaging 1.00
R2178:Mcoln1 UTSW 8 3508766 missense probably damaging 1.00
R2218:Mcoln1 UTSW 8 3505813 missense possibly damaging 0.50
R3828:Mcoln1 UTSW 8 3500601 missense possibly damaging 0.93
R3875:Mcoln1 UTSW 8 3508355 missense probably benign
R4621:Mcoln1 UTSW 8 3505923 missense probably damaging 1.00
R4622:Mcoln1 UTSW 8 3505923 missense probably damaging 1.00
R4659:Mcoln1 UTSW 8 3510840 missense probably damaging 1.00
R4873:Mcoln1 UTSW 8 3507422 missense probably benign 0.00
R4875:Mcoln1 UTSW 8 3507422 missense probably benign 0.00
R4914:Mcoln1 UTSW 8 3507483 nonsense probably null
R5114:Mcoln1 UTSW 8 3510697 unclassified probably benign
R5586:Mcoln1 UTSW 8 3510389 missense probably damaging 1.00
R5876:Mcoln1 UTSW 8 3510910 missense probably damaging 1.00
R5946:Mcoln1 UTSW 8 3508701 missense probably damaging 1.00
R6520:Mcoln1 UTSW 8 3505855 missense probably damaging 1.00
R7449:Mcoln1 UTSW 8 3507285 missense probably damaging 0.98
R7712:Mcoln1 UTSW 8 3505873 missense probably damaging 0.99
R7904:Mcoln1 UTSW 8 3508356 missense probably benign
R7936:Mcoln1 UTSW 8 3505924 missense probably damaging 1.00
R8058:Mcoln1 UTSW 8 3508378 missense probably benign
R8082:Mcoln1 UTSW 8 3507420 missense probably benign 0.01
R8093:Mcoln1 UTSW 8 3508740 missense possibly damaging 0.95
R9090:Mcoln1 UTSW 8 3505771 missense probably damaging 1.00
R9271:Mcoln1 UTSW 8 3505771 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAAGAGAACACCATTGCCTTC -3'
(R):5'- GCCTACACACCCCATAGTTAGG -3'

Sequencing Primer
(F):5'- GACATCTCTTCCTGCTGGG -3'
(R):5'- ACCCCATAGTTAGGCCCTG -3'
Posted On 2015-04-29